Incidental Mutation 'R0111:Zfp953'
ID20470
Institutional Source Beutler Lab
Gene Symbol Zfp953
Ensembl Gene ENSMUSG00000098905
Gene Namezinc finger protein 953
SynonymsE130120F12Rik
MMRRC Submission 038397-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R0111 (G1)
Quality Score225
Status Validated (trace)
Chromosome13
Chromosomal Location67339306-67360605 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67343075 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 271 (H271L)
Ref Sequence ENSEMBL: ENSMUSP00000076700 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044819] [ENSMUST00000081582] [ENSMUST00000166080]
Predicted Effect probably benign
Transcript: ENSMUST00000044819
SMART Domains Protein: ENSMUSP00000049225
Gene: ENSMUSG00000098781

DomainStartEndE-ValueType
KRAB 5 65 1.15e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081582
AA Change: H271L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076700
Gene: ENSMUSG00000098905
AA Change: H271L

DomainStartEndE-ValueType
KRAB 5 65 1.15e-23 SMART
ZnF_C2H2 81 103 3.11e-2 SMART
ZnF_C2H2 109 131 8.94e-3 SMART
ZnF_C2H2 137 159 6.23e-2 SMART
ZnF_C2H2 165 187 3.63e-3 SMART
ZnF_C2H2 193 215 1.06e-4 SMART
ZnF_C2H2 221 243 7.05e-1 SMART
ZnF_C2H2 249 271 5.42e-2 SMART
ZnF_C2H2 277 299 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166080
SMART Domains Protein: ENSMUSP00000126669
Gene: ENSMUSG00000098692

DomainStartEndE-ValueType
KRAB 2 62 3.07e-33 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170543
Meta Mutation Damage Score 0.45 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre4 A T 17: 55,817,073 H491L possibly damaging Het
Adgrg3 T C 8: 95,035,110 probably benign Het
Arhgap5 T C 12: 52,559,960 probably benign Het
Asic1 T C 15: 99,696,983 Y334H probably damaging Het
Calcr T A 6: 3,717,157 D101V probably damaging Het
Cdh2 A T 18: 16,774,509 N57K probably benign Het
Clec4d C A 6: 123,268,047 Y95* probably null Het
Cracr2a A G 6: 127,604,061 T67A probably benign Het
Dennd5a A T 7: 109,934,754 V53D probably damaging Het
Dnah7a T C 1: 53,468,684 D3076G probably benign Het
Espnl T C 1: 91,344,742 M608T probably benign Het
Fam149a C T 8: 45,341,146 probably benign Het
Fam35a T C 14: 34,267,729 K407E probably damaging Het
Fam46c T C 3: 100,472,786 D218G probably damaging Het
Flnc T C 6: 29,454,340 V1884A probably damaging Het
Helz2 A C 2: 181,237,802 S674R probably benign Het
Hoxa2 T G 6: 52,164,487 probably null Het
Ifi47 T A 11: 49,096,070 N221K probably damaging Het
Ipo9 A G 1: 135,405,924 V340A probably damaging Het
Kalrn A T 16: 34,031,590 N373K probably damaging Het
Kif26a T C 12: 112,163,337 probably benign Het
Kiss1r A G 10: 79,918,689 T6A possibly damaging Het
Lama1 A T 17: 67,737,498 I131F probably damaging Het
Nefm T C 14: 68,124,542 D91G probably benign Het
Nos3 C T 5: 24,372,704 T572I probably damaging Het
Notch2 T C 3: 98,138,761 F1710L probably benign Het
Olfr70 T C 4: 43,696,648 N175S probably damaging Het
Olfr804 T A 10: 129,705,277 I133N probably damaging Het
Ostm1 T C 10: 42,679,258 L92P probably damaging Het
Pcdh15 T A 10: 74,626,819 Y1445* probably null Het
Pde1b T C 15: 103,503,513 S14P probably benign Het
Pitpna T C 11: 75,625,484 V265A probably benign Het
Plec G T 15: 76,178,646 T2476K probably damaging Het
Pold2 A G 11: 5,876,760 L58P probably damaging Het
Ppp3cc C T 14: 70,256,359 probably null Het
Prss36 A G 7: 127,934,545 L530P probably damaging Het
Ptpn13 T C 5: 103,580,763 probably benign Het
Ptpn23 T C 9: 110,385,623 D1570G probably damaging Het
Rab42 T C 4: 132,302,365 D182G possibly damaging Het
Rbm27 T A 18: 42,305,672 probably benign Het
Rp1 T C 1: 4,344,760 E2043G probably damaging Het
Rufy3 C T 5: 88,630,584 S341F probably damaging Het
Samd9l C T 6: 3,374,946 V772I possibly damaging Het
Scaper A G 9: 55,602,790 M654T probably benign Het
Sipa1l3 G A 7: 29,348,318 P333S probably damaging Het
Slc30a10 C A 1: 185,455,547 R162S probably benign Het
Spryd3 A T 15: 102,128,537 probably null Het
Tas2r110 T C 6: 132,868,203 F66L probably benign Het
Thap2 T C 10: 115,372,627 N196S probably benign Het
Themis2 C A 4: 132,789,925 R88L probably benign Het
Trip12 A T 1: 84,759,133 probably benign Het
Ube3b T A 5: 114,390,376 probably benign Het
Usp20 T A 2: 31,002,612 H64Q probably damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r15 T C 5: 109,287,156 R561G possibly damaging Het
Vsig10l A G 7: 43,468,101 D604G probably damaging Het
Wdr90 A G 17: 25,848,444 probably benign Het
Xirp2 A T 2: 67,508,378 N321I probably damaging Het
Zfp595 A G 13: 67,320,920 F11S possibly damaging Het
Other mutations in Zfp953
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03034:Zfp953 APN 13 67343462 missense probably damaging 1.00
IGL03347:Zfp953 APN 13 67343426 missense probably benign 0.05
R1856:Zfp953 UTSW 13 67345358 missense probably benign 0.02
R2518:Zfp953 UTSW 13 67347939 missense probably damaging 0.99
R3925:Zfp953 UTSW 13 67347938 missense probably damaging 0.99
R4777:Zfp953 UTSW 13 67343129 missense probably benign 0.42
R5647:Zfp953 UTSW 13 67343472 missense possibly damaging 0.90
R6232:Zfp953 UTSW 13 67343097 missense possibly damaging 0.94
R6481:Zfp953 UTSW 13 67347937 nonsense probably null
R7202:Zfp953 UTSW 13 67343642 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGCCACGTACTTCATATTTGTAGGACTT -3'
(R):5'- GGGCCTTCCATGTTCCATCAAAACT -3'

Sequencing Primer
(F):5'- atggggggtgggtatgg -3'
(R):5'- ccttccactcttcaccatcac -3'
Posted On2013-04-11