Incidental Mutation 'R1832:Mixl1'
ID204834
Institutional Source Beutler Lab
Gene Symbol Mixl1
Ensembl Gene ENSMUSG00000026497
Gene NameMix1 homeobox-like 1 (Xenopus laevis)
SynonymsMml
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location180693043-180697034 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180694731 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 195 (V195A)
Ref Sequence ENSEMBL: ENSMUSP00000027778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027778] [ENSMUST00000192561] [ENSMUST00000192725] [ENSMUST00000193892]
Predicted Effect probably benign
Transcript: ENSMUST00000027778
AA Change: V195A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000027778
Gene: ENSMUSG00000026497
AA Change: V195A

DomainStartEndE-ValueType
low complexity region 72 85 N/A INTRINSIC
HOX 86 148 1.58e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192561
SMART Domains Protein: ENSMUSP00000141331
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 143 248 2.2e-71 SMART
coiled coil region 370 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192725
SMART Domains Protein: ENSMUSP00000141503
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 103 208 2.2e-71 SMART
coiled coil region 330 388 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000193892
SMART Domains Protein: ENSMUSP00000141530
Gene: ENSMUSG00000058729

DomainStartEndE-ValueType
DIRP 127 232 2.2e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194847
Meta Mutation Damage Score 0.1148 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Homeodomain proteins, such as MIXL1, are transcription factors that regulate cell fate during development (Hart et al., 2005 [PubMed 15982639]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous null embryos are mostly arrested in development by E9 exhibiting abnormalities in primitive streak and node formation, disorganized head folds, foreshortened body axis, absence of heart tube and gut, deficient paraxial mesoderm, abnormal notochord morphology, and an enlarged allantois. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Mixl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02548:Mixl1 APN 1 180694704 missense probably benign 0.03
IGL03371:Mixl1 APN 1 180694626 missense probably benign 0.00
R0453:Mixl1 UTSW 1 180696646 missense probably damaging 1.00
R0838:Mixl1 UTSW 1 180696800 missense probably benign 0.45
R4870:Mixl1 UTSW 1 180694672 missense probably benign 0.06
R6046:Mixl1 UTSW 1 180696771 missense possibly damaging 0.94
R6918:Mixl1 UTSW 1 180694678 missense probably benign 0.02
R6980:Mixl1 UTSW 1 180696888 missense possibly damaging 0.51
R7047:Mixl1 UTSW 1 180696618 critical splice donor site probably null
X0065:Mixl1 UTSW 1 180694701 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTGAGAGATGATCCAGAACC -3'
(R):5'- CCCAGGTGTGGTTCCAGAAC -3'

Sequencing Primer
(F):5'- TGATCCAGAACCGAGGCCATG -3'
(R):5'- AGAACCGACGGGCCAAGTC -3'
Posted On2014-06-23