Incidental Mutation 'R1832:Plxna4'
ID204862
Institutional Source Beutler Lab
Gene Symbol Plxna4
Ensembl Gene ENSMUSG00000029765
Gene Nameplexin A4
SynonymsPlxa4
MMRRC Submission 039859-MU
Accession Numbers

Genbank: NM_175750

Is this an essential gene? Possibly essential (E-score: 0.637) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location32144268-32588192 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 32197826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 1109 (D1109E)
Ref Sequence ENSEMBL: ENSMUSP00000110748 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115096]
Predicted Effect probably benign
Transcript: ENSMUST00000115096
AA Change: D1109E

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110748
Gene: ENSMUSG00000029765
AA Change: D1109E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 490 2.3e-131 SMART
PSI 508 558 2.21e-14 SMART
PSI 654 701 2.44e-7 SMART
PSI 802 855 1.2e-6 SMART
IPT 856 950 7.25e-16 SMART
IPT 952 1036 4.1e-15 SMART
IPT 1038 1138 2.86e-14 SMART
IPT 1140 1229 6.88e-1 SMART
transmembrane domain 1237 1259 N/A INTRINSIC
Pfam:Plexin_cytopl 1310 1863 1.8e-264 PFAM
Meta Mutation Damage Score 0.1332 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit defective trajecotory and projection of peripheral sensory axons and sympathetic ganglion axons and the formation of the anterior commissure and the barrels. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sbno2 G T 10: 80,060,605 Y889* probably null Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Plxna4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Plxna4 APN 6 32162091 missense probably damaging 1.00
IGL01395:Plxna4 APN 6 32239433 missense probably damaging 0.99
IGL01506:Plxna4 APN 6 32516535 missense probably damaging 1.00
IGL01606:Plxna4 APN 6 32158001 missense probably damaging 1.00
IGL01753:Plxna4 APN 6 32310478 missense probably benign 0.06
IGL01767:Plxna4 APN 6 32237678 missense possibly damaging 0.51
IGL01968:Plxna4 APN 6 32215204 missense possibly damaging 0.81
IGL02109:Plxna4 APN 6 32215641 missense probably benign
IGL02299:Plxna4 APN 6 32165156 missense probably benign 0.01
IGL02306:Plxna4 APN 6 32206124 missense probably benign 0.19
IGL02312:Plxna4 APN 6 32165117 missense possibly damaging 0.79
IGL02326:Plxna4 APN 6 32152905 missense probably damaging 0.99
IGL02658:Plxna4 APN 6 32185411 missense probably damaging 1.00
IGL02683:Plxna4 APN 6 32517606 missense probably benign 0.03
IGL02701:Plxna4 APN 6 32517559 missense probably benign 0.01
IGL02995:Plxna4 APN 6 32516595 missense probably damaging 1.00
IGL03030:Plxna4 APN 6 32202225 missense probably benign 0.01
IGL03264:Plxna4 APN 6 32178402 missense possibly damaging 0.64
IGL03304:Plxna4 APN 6 32165051 splice site probably benign
IGL03382:Plxna4 APN 6 32202194 missense probably benign 0.23
inclined UTSW 6 32237723 nonsense probably null
slope UTSW 6 32234606 missense probably benign 0.00
G4846:Plxna4 UTSW 6 32192272 missense probably damaging 1.00
R0133:Plxna4 UTSW 6 32197074 missense probably benign 0.00
R0200:Plxna4 UTSW 6 32197088 missense probably damaging 0.99
R0308:Plxna4 UTSW 6 32237768 missense probably benign 0.01
R0468:Plxna4 UTSW 6 32215246 missense probably damaging 1.00
R0505:Plxna4 UTSW 6 32202119 missense probably benign
R0542:Plxna4 UTSW 6 32192297 missense probably damaging 1.00
R0548:Plxna4 UTSW 6 32158015 missense probably damaging 1.00
R0652:Plxna4 UTSW 6 32185501 missense probably damaging 1.00
R1144:Plxna4 UTSW 6 32197156 missense possibly damaging 0.58
R1190:Plxna4 UTSW 6 32251136 missense probably damaging 1.00
R1228:Plxna4 UTSW 6 32224152 splice site probably null
R1569:Plxna4 UTSW 6 32185475 missense possibly damaging 0.78
R1803:Plxna4 UTSW 6 32517444 missense probably damaging 0.98
R2068:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R2157:Plxna4 UTSW 6 32516974 missense probably benign 0.00
R2842:Plxna4 UTSW 6 32215631 critical splice donor site probably null
R2849:Plxna4 UTSW 6 32185532 missense probably damaging 1.00
R2892:Plxna4 UTSW 6 32517037 missense probably damaging 1.00
R2930:Plxna4 UTSW 6 32165780 missense probably damaging 1.00
R3892:Plxna4 UTSW 6 32215654 missense probably damaging 1.00
R4065:Plxna4 UTSW 6 32236365 nonsense probably null
R4276:Plxna4 UTSW 6 32200948 missense probably benign 0.29
R4307:Plxna4 UTSW 6 32163509 missense probably damaging 0.99
R4331:Plxna4 UTSW 6 32150545 nonsense probably null
R4478:Plxna4 UTSW 6 32196133 missense possibly damaging 0.89
R4529:Plxna4 UTSW 6 32496896 critical splice acceptor site probably null
R4566:Plxna4 UTSW 6 32517403 missense probably benign 0.00
R4568:Plxna4 UTSW 6 32152938 missense probably damaging 1.00
R4664:Plxna4 UTSW 6 32516950 missense possibly damaging 0.88
R4685:Plxna4 UTSW 6 32165844 missense probably damaging 1.00
R4701:Plxna4 UTSW 6 32516688 missense probably damaging 0.99
R4939:Plxna4 UTSW 6 32165762 missense probably damaging 1.00
R5153:Plxna4 UTSW 6 32224159 intron probably null
R5181:Plxna4 UTSW 6 32516997 missense probably damaging 1.00
R5256:Plxna4 UTSW 6 32251072 missense probably benign 0.03
R5259:Plxna4 UTSW 6 32517021 missense possibly damaging 0.89
R5306:Plxna4 UTSW 6 32206121 missense probably damaging 0.99
R5487:Plxna4 UTSW 6 32517283 missense probably damaging 1.00
R5510:Plxna4 UTSW 6 32178358 missense probably damaging 0.96
R5542:Plxna4 UTSW 6 32206230 missense probably damaging 1.00
R5567:Plxna4 UTSW 6 32157980 missense possibly damaging 0.61
R5634:Plxna4 UTSW 6 32237723 nonsense probably null
R5653:Plxna4 UTSW 6 32517616 missense possibly damaging 0.66
R5665:Plxna4 UTSW 6 32215722 missense probably damaging 1.00
R5845:Plxna4 UTSW 6 32237776 missense probably damaging 1.00
R5909:Plxna4 UTSW 6 32517246 missense probably damaging 1.00
R5938:Plxna4 UTSW 6 32234606 missense probably benign 0.00
R5973:Plxna4 UTSW 6 32251065 splice site probably null
R6433:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6482:Plxna4 UTSW 6 32516737 missense probably benign
R6560:Plxna4 UTSW 6 32215678 missense probably damaging 0.97
R6721:Plxna4 UTSW 6 32200859 missense probably benign 0.26
R6810:Plxna4 UTSW 6 32310522 missense probably benign 0.18
R6985:Plxna4 UTSW 6 32237708 missense probably damaging 1.00
R7024:Plxna4 UTSW 6 32192269 missense probably damaging 1.00
R7046:Plxna4 UTSW 6 32516505 missense probably damaging 1.00
R7137:Plxna4 UTSW 6 32517264 missense not run
V1024:Plxna4 UTSW 6 32234574 missense probably damaging 1.00
X0027:Plxna4 UTSW 6 32517044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATCGGTAACTGAAATGCCATG -3'
(R):5'- TAAGAGTATGGTCCTGGCTGCC -3'

Sequencing Primer
(F):5'- TCGGTAACTGAAATGCCATGAAAAAC -3'
(R):5'- GGCTGCCTCCATCGTAATC -3'
Posted On2014-06-23