Incidental Mutation 'R1832:Sbno2'
ID204879
Institutional Source Beutler Lab
Gene Symbol Sbno2
Ensembl Gene ENSMUSG00000035673
Gene Namestrawberry notch 2
SynonymsStno
MMRRC Submission 039859-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.476) question?
Stock #R1832 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location80056992-80105571 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 80060605 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 889 (Y889*)
Ref Sequence ENSEMBL: ENSMUSP00000151590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042771] [ENSMUST00000097227] [ENSMUST00000105372] [ENSMUST00000183037] [ENSMUST00000217972] [ENSMUST00000218630] [ENSMUST00000219260]
Predicted Effect probably null
Transcript: ENSMUST00000042771
AA Change: Y889*
SMART Domains Protein: ENSMUSP00000041635
Gene: ENSMUSG00000035673
AA Change: Y889*

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
low complexity region 177 189 N/A INTRINSIC
Pfam:AAA_34 209 500 8.2e-135 PFAM
Pfam:ResIII 239 419 7.7e-8 PFAM
low complexity region 611 631 N/A INTRINSIC
Pfam:Helicase_C_4 726 1004 7.5e-120 PFAM
low complexity region 1263 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097227
SMART Domains Protein: ENSMUSP00000094863
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
low complexity region 2 55 N/A INTRINSIC
Pfam:GSHPx 97 204 6e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105372
SMART Domains Protein: ENSMUSP00000101011
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:GSHPx 41 148 1.3e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144698
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154095
Predicted Effect probably benign
Transcript: ENSMUST00000183037
SMART Domains Protein: ENSMUSP00000138186
Gene: ENSMUSG00000075706

DomainStartEndE-ValueType
Pfam:GSHPx 1 108 3.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217876
Predicted Effect probably benign
Transcript: ENSMUST00000217972
Predicted Effect probably null
Transcript: ENSMUST00000218630
AA Change: Y889*
Predicted Effect probably null
Transcript: ENSMUST00000219260
AA Change: Y889*
Meta Mutation Damage Score 0.616 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired osteoclast fusion, impaired osteoblastogenesis, osteopetrosis, increased bone mass, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
Abca8a A T 11: 110,071,451 N525K probably damaging Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adamts20 A T 15: 94,286,344 M1526K probably benign Het
AI481877 T G 4: 59,066,441 I768L probably benign Het
Ankdd1a A T 9: 65,504,489 probably null Het
Ankrd1 C T 19: 36,114,978 C283Y possibly damaging Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Bhlhe22 G A 3: 18,054,975 C63Y probably damaging Het
Bmp8a A T 4: 123,325,092 probably benign Het
Ccdc148 A T 2: 59,001,899 S235T probably damaging Het
Ccdc88b G A 19: 6,853,532 Q681* probably null Het
Cep104 T A 4: 154,002,546 V842E probably benign Het
Chac2 T C 11: 30,977,568 N117S probably benign Het
Cldn8 T A 16: 88,562,858 I60F probably benign Het
Col16a1 G A 4: 130,077,057 probably null Het
Col4a1 A G 8: 11,214,644 probably benign Het
Cyp2a4 G T 7: 26,312,210 E285D probably damaging Het
Cyp4a31 G A 4: 115,569,731 G176D probably benign Het
Dmxl2 A C 9: 54,460,949 Y246D probably damaging Het
Dync1h1 A G 12: 110,614,059 K118R probably damaging Het
Eif3h T C 15: 51,865,436 T8A possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Fbxo18 G T 2: 11,767,400 L157I probably benign Het
Fbxo40 C A 16: 36,968,856 G631* probably null Het
Gabrb1 T A 5: 72,121,938 probably null Het
Galc A G 12: 98,234,240 probably null Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Igkv13-54-1 A T 6: 69,617,293 M31L probably benign Het
Lamc2 C T 1: 153,166,187 R67Q possibly damaging Het
Lcn10 A G 2: 25,685,139 D173G probably damaging Het
Llgl2 G T 11: 115,851,100 R656L probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc66 G A 5: 73,607,426 S758L possibly damaging Het
Ly6d T C 15: 74,762,766 K46E probably damaging Het
Map3k5 A G 10: 20,099,560 N88D probably damaging Het
Mertk A T 2: 128,762,212 E422V probably benign Het
Mixl1 A G 1: 180,694,731 V195A probably benign Het
Nmnat3 T C 9: 98,399,468 V41A probably damaging Het
Olfr13 A G 6: 43,174,900 R305G probably benign Het
Olfr398 A T 11: 73,984,493 N38K probably damaging Het
Olfr854 A G 9: 19,567,196 Y63H possibly damaging Het
Pappa2 T A 1: 158,857,316 E751V probably damaging Het
Pcsk2 A G 2: 143,793,269 S355G probably damaging Het
Pdzd2 A G 15: 12,390,048 V821A probably damaging Het
Pifo C T 3: 106,014,596 E4K possibly damaging Het
Plxna4 A C 6: 32,197,826 D1109E probably benign Het
Ppard A G 17: 28,297,110 M103V probably benign Het
Ralgapa1 T C 12: 55,757,967 T515A probably benign Het
Rin2 A G 2: 145,861,171 I596V possibly damaging Het
Rnls A G 19: 33,168,495 S75P possibly damaging Het
Rsph10b A T 5: 143,967,179 Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 probably benign Het
Sardh A G 2: 27,235,569 V311A possibly damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4g T A 19: 44,999,017 V534E probably benign Het
Slc10a1 G A 12: 80,953,672 S351F probably benign Het
Slc19a3 A T 1: 83,022,747 V183E probably damaging Het
Slc25a12 A G 2: 71,333,710 Y74H possibly damaging Het
Slc6a19 T A 13: 73,692,950 I114L probably benign Het
Smpd2 A T 10: 41,488,236 C189S probably benign Het
Spon1 T A 7: 114,016,785 V295D probably benign Het
Tet3 A G 6: 83,403,645 S514P probably benign Het
Tnk1 T C 11: 69,856,928 I49M probably damaging Het
Trim80 A G 11: 115,446,793 T431A probably benign Het
Vgf A T 5: 137,031,299 Q105L possibly damaging Het
Vmn1r37 G T 6: 66,731,796 L135F probably benign Het
Vps37d C T 5: 135,073,740 A128T possibly damaging Het
Wdr60 T A 12: 116,207,743 S958C probably damaging Het
Wwp1 T C 4: 19,650,197 D323G probably benign Het
Zfp456 T A 13: 67,367,363 I75L probably benign Het
Zfp990 A G 4: 145,538,210 I593V possibly damaging Het
Other mutations in Sbno2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sbno2 APN 10 80064506 splice site probably benign
IGL01773:Sbno2 APN 10 80057831 missense probably damaging 1.00
IGL01869:Sbno2 APN 10 80060392 critical splice donor site probably null
IGL01911:Sbno2 APN 10 80069624 nonsense probably null
IGL02071:Sbno2 APN 10 80060641 missense probably damaging 1.00
IGL02094:Sbno2 APN 10 80057645 missense probably benign
IGL02220:Sbno2 APN 10 80072368 missense probably benign 0.04
IGL02366:Sbno2 APN 10 80064202 missense probably damaging 1.00
IGL02608:Sbno2 APN 10 80067402 splice site probably null
IGL03007:Sbno2 APN 10 80058550 splice site probably benign
IGL03083:Sbno2 APN 10 80057534 missense probably damaging 0.98
IGL03393:Sbno2 APN 10 80066901 missense probably damaging 1.00
R0034:Sbno2 UTSW 10 80058340 splice site probably benign
R0126:Sbno2 UTSW 10 80068853 splice site probably null
R0652:Sbno2 UTSW 10 80067294 missense probably damaging 1.00
R0964:Sbno2 UTSW 10 80084259 missense possibly damaging 0.75
R1571:Sbno2 UTSW 10 80060392 critical splice donor site probably null
R1601:Sbno2 UTSW 10 80060492 missense probably damaging 0.98
R1634:Sbno2 UTSW 10 80060634 missense possibly damaging 0.73
R1733:Sbno2 UTSW 10 80058508 missense possibly damaging 0.92
R1762:Sbno2 UTSW 10 80066606 missense probably damaging 1.00
R1859:Sbno2 UTSW 10 80058639 nonsense probably null
R2086:Sbno2 UTSW 10 80057856 missense possibly damaging 0.89
R2136:Sbno2 UTSW 10 80062693 missense probably damaging 1.00
R2360:Sbno2 UTSW 10 80058021 missense possibly damaging 0.81
R4426:Sbno2 UTSW 10 80072358 missense probably null 0.02
R4504:Sbno2 UTSW 10 80060492 missense possibly damaging 0.46
R4692:Sbno2 UTSW 10 80086327 missense possibly damaging 0.90
R5044:Sbno2 UTSW 10 80062188 missense probably benign 0.11
R5166:Sbno2 UTSW 10 80066928 nonsense probably null
R5576:Sbno2 UTSW 10 80067337 missense probably damaging 0.99
R5665:Sbno2 UTSW 10 80058453 missense probably benign 0.00
R5709:Sbno2 UTSW 10 80086337 start codon destroyed probably null 0.89
R5828:Sbno2 UTSW 10 80066590 missense possibly damaging 0.84
R6192:Sbno2 UTSW 10 80060016 missense probably damaging 0.99
R6971:Sbno2 UTSW 10 80060034 missense possibly damaging 0.95
R7012:Sbno2 UTSW 10 80069518 intron probably benign
R7133:Sbno2 UTSW 10 80086312 missense not run
X0026:Sbno2 UTSW 10 80057459 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- AAAGAAGGCGGTATCCCCTC -3'
(R):5'- CTCGAAAGTCTGGTGAGCATGC -3'

Sequencing Primer
(F):5'- CGGTATCCCCTCCTGGATAG -3'
(R):5'- TGAGCATGCTGGGCCTGAG -3'
Posted On2014-06-23