Incidental Mutation 'R1832:Dync2i1'
ID 204892
Institutional Source Beutler Lab
Gene Symbol Dync2i1
Ensembl Gene ENSMUSG00000042050
Gene Name dynein 2 intermediate chain 1
Synonyms Dync2l1, D430033N04Rik, Wdr60
MMRRC Submission 039859-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1832 (G1)
Quality Score 225
Status Validated
Chromosome 12
Chromosomal Location 116169882-116226642 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116171363 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Cysteine at position 958 (S958C)
Ref Sequence ENSEMBL: ENSMUSP00000047334 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039349]
AlphaFold Q8C761
Predicted Effect probably damaging
Transcript: ENSMUST00000039349
AA Change: S958C

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000047334
Gene: ENSMUSG00000042050
AA Change: S958C

DomainStartEndE-ValueType
coiled coil region 84 122 N/A INTRINSIC
low complexity region 168 193 N/A INTRINSIC
low complexity region 226 242 N/A INTRINSIC
coiled coil region 280 309 N/A INTRINSIC
low complexity region 319 337 N/A INTRINSIC
low complexity region 439 453 N/A INTRINSIC
WD40 629 668 2.77e-1 SMART
Blast:WD40 694 755 2e-7 BLAST
WD40 846 881 3.84e0 SMART
WD40 884 926 5.55e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221748
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222764
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.6%
  • 20x: 90.7%
Validation Efficiency 100% (82/82)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) and may facilitate the formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein contains four WD repeats and may play a role in the formation of cilia. Mutations in this gene have been associated with short-rib polydactyly and Jeune syndromes. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,350,509 (GRCm39) D143V unknown Het
Abca8a A T 11: 109,962,277 (GRCm39) N525K probably damaging Het
Abhd12 T A 2: 150,690,338 (GRCm39) D119V probably damaging Het
Adamts20 A T 15: 94,184,225 (GRCm39) M1526K probably benign Het
Ankdd1a A T 9: 65,411,771 (GRCm39) probably null Het
Ankrd1 C T 19: 36,092,378 (GRCm39) C283Y possibly damaging Het
Arfgef1 G C 1: 10,275,115 (GRCm39) I312M probably benign Het
Bhlhe22 G A 3: 18,109,139 (GRCm39) C63Y probably damaging Het
Bmp8a A T 4: 123,218,885 (GRCm39) probably benign Het
Ccdc148 A T 2: 58,891,911 (GRCm39) S235T probably damaging Het
Ccdc88b G A 19: 6,830,900 (GRCm39) Q681* probably null Het
Cep104 T A 4: 154,087,003 (GRCm39) V842E probably benign Het
Chac2 T C 11: 30,927,568 (GRCm39) N117S probably benign Het
Cimap3 C T 3: 105,921,912 (GRCm39) E4K possibly damaging Het
Cldn8 T A 16: 88,359,746 (GRCm39) I60F probably benign Het
Col16a1 G A 4: 129,970,850 (GRCm39) probably null Het
Col4a1 A G 8: 11,264,644 (GRCm39) probably benign Het
Cyp2a4 G T 7: 26,011,635 (GRCm39) E285D probably damaging Het
Cyp4a31 G A 4: 115,426,928 (GRCm39) G176D probably benign Het
Dmxl2 A C 9: 54,368,233 (GRCm39) Y246D probably damaging Het
Dync1h1 A G 12: 110,580,493 (GRCm39) K118R probably damaging Het
Eif3h T C 15: 51,728,832 (GRCm39) T8A possibly damaging Het
Fbh1 G T 2: 11,772,211 (GRCm39) L157I probably benign Het
Fbxo40 C A 16: 36,789,218 (GRCm39) G631* probably null Het
Gabrb1 T A 5: 72,279,281 (GRCm39) probably null Het
Galc A G 12: 98,200,499 (GRCm39) probably null Het
Garin2 G A 12: 78,762,280 (GRCm39) probably benign Het
H2-Q7 C A 17: 35,658,675 (GRCm39) S104R probably benign Het
Igkv13-54-1 A T 6: 69,594,277 (GRCm39) M31L probably benign Het
Lamc2 C T 1: 153,041,933 (GRCm39) R67Q possibly damaging Het
Lcn10 A G 2: 25,575,151 (GRCm39) D173G probably damaging Het
Llgl2 G T 11: 115,741,926 (GRCm39) R656L probably damaging Het
Lonrf2 G A 1: 38,852,357 (GRCm39) P165S probably benign Het
Lrrc66 G A 5: 73,764,769 (GRCm39) S758L possibly damaging Het
Ly6d T C 15: 74,634,615 (GRCm39) K46E probably damaging Het
Map3k5 A G 10: 19,975,306 (GRCm39) N88D probably damaging Het
Mertk A T 2: 128,604,132 (GRCm39) E422V probably benign Het
Mixl1 A G 1: 180,522,296 (GRCm39) V195A probably benign Het
Nmnat3 T C 9: 98,281,521 (GRCm39) V41A probably damaging Het
Or1r1 A T 11: 73,875,319 (GRCm39) N38K probably damaging Het
Or2a7 A G 6: 43,151,834 (GRCm39) R305G probably benign Het
Or7g34 A G 9: 19,478,492 (GRCm39) Y63H possibly damaging Het
Pappa2 T A 1: 158,684,886 (GRCm39) E751V probably damaging Het
Pcsk2 A G 2: 143,635,189 (GRCm39) S355G probably damaging Het
Pdzd2 A G 15: 12,390,134 (GRCm39) V821A probably damaging Het
Plxna4 A C 6: 32,174,761 (GRCm39) D1109E probably benign Het
Ppard A G 17: 28,516,084 (GRCm39) M103V probably benign Het
Pramel51 T C 12: 88,145,218 (GRCm39) E44G possibly damaging Het
Ralgapa1 T C 12: 55,804,752 (GRCm39) T515A probably benign Het
Rin2 A G 2: 145,703,091 (GRCm39) I596V possibly damaging Het
Rnls A G 19: 33,145,895 (GRCm39) S75P possibly damaging Het
Rsph10b A T 5: 143,903,997 (GRCm39) Y236F possibly damaging Het
Runx1t1 C T 4: 13,835,628 (GRCm39) probably benign Het
Sardh A G 2: 27,125,581 (GRCm39) V311A possibly damaging Het
Sbno2 G T 10: 79,896,439 (GRCm39) Y889* probably null Het
Sclt1 A G 3: 41,681,546 (GRCm39) V91A probably damaging Het
Sema4g T A 19: 44,987,456 (GRCm39) V534E probably benign Het
Shoc1 T G 4: 59,066,441 (GRCm39) I768L probably benign Het
Slc10a1 G A 12: 81,000,446 (GRCm39) S351F probably benign Het
Slc19a3 A T 1: 83,000,468 (GRCm39) V183E probably damaging Het
Slc25a12 A G 2: 71,164,054 (GRCm39) Y74H possibly damaging Het
Slc6a19 T A 13: 73,841,069 (GRCm39) I114L probably benign Het
Smpd2 A T 10: 41,364,232 (GRCm39) C189S probably benign Het
Spon1 T A 7: 113,616,018 (GRCm39) V295D probably benign Het
Tet3 A G 6: 83,380,627 (GRCm39) S514P probably benign Het
Tnk1 T C 11: 69,747,754 (GRCm39) I49M probably damaging Het
Trim80 A G 11: 115,337,619 (GRCm39) T431A probably benign Het
Vgf A T 5: 137,060,153 (GRCm39) Q105L possibly damaging Het
Vmn1r37 G T 6: 66,708,780 (GRCm39) L135F probably benign Het
Vps37d C T 5: 135,102,594 (GRCm39) A128T possibly damaging Het
Wwp1 T C 4: 19,650,197 (GRCm39) D323G probably benign Het
Zfp456 T A 13: 67,515,482 (GRCm39) I75L probably benign Het
Zfp990 A G 4: 145,264,780 (GRCm39) I593V possibly damaging Het
Other mutations in Dync2i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00586:Dync2i1 APN 12 116,205,400 (GRCm39) missense probably benign 0.01
IGL00668:Dync2i1 APN 12 116,221,048 (GRCm39) missense probably benign 0.32
IGL00914:Dync2i1 APN 12 116,196,223 (GRCm39) missense probably damaging 1.00
IGL01061:Dync2i1 APN 12 116,193,324 (GRCm39) missense probably benign 0.45
IGL01375:Dync2i1 APN 12 116,193,296 (GRCm39) missense possibly damaging 0.91
IGL01758:Dync2i1 APN 12 116,182,418 (GRCm39) missense possibly damaging 0.82
IGL01930:Dync2i1 APN 12 116,189,583 (GRCm39) critical splice donor site probably null
IGL02028:Dync2i1 APN 12 116,219,681 (GRCm39) missense probably benign 0.06
IGL03180:Dync2i1 APN 12 116,182,485 (GRCm39) missense probably benign 0.07
F5770:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
R0153:Dync2i1 UTSW 12 116,196,256 (GRCm39) missense probably benign 0.01
R0265:Dync2i1 UTSW 12 116,221,026 (GRCm39) splice site probably benign
R0364:Dync2i1 UTSW 12 116,221,097 (GRCm39) splice site probably benign
R0601:Dync2i1 UTSW 12 116,219,555 (GRCm39) missense possibly damaging 0.79
R0624:Dync2i1 UTSW 12 116,211,910 (GRCm39) missense probably damaging 0.98
R0755:Dync2i1 UTSW 12 116,175,412 (GRCm39) missense probably benign 0.01
R1023:Dync2i1 UTSW 12 116,196,277 (GRCm39) missense probably damaging 1.00
R1065:Dync2i1 UTSW 12 116,219,696 (GRCm39) missense probably damaging 0.98
R1543:Dync2i1 UTSW 12 116,195,404 (GRCm39) splice site probably benign
R1663:Dync2i1 UTSW 12 116,193,230 (GRCm39) missense probably benign 0.01
R1678:Dync2i1 UTSW 12 116,189,590 (GRCm39) missense probably damaging 1.00
R1719:Dync2i1 UTSW 12 116,219,532 (GRCm39) missense probably benign
R1755:Dync2i1 UTSW 12 116,189,649 (GRCm39) missense probably damaging 0.98
R1918:Dync2i1 UTSW 12 116,196,221 (GRCm39) missense probably damaging 0.96
R2291:Dync2i1 UTSW 12 116,193,191 (GRCm39) splice site probably null
R2444:Dync2i1 UTSW 12 116,196,289 (GRCm39) missense possibly damaging 0.93
R3419:Dync2i1 UTSW 12 116,188,597 (GRCm39) missense probably benign 0.05
R3699:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R3700:Dync2i1 UTSW 12 116,175,462 (GRCm39) nonsense probably null
R4445:Dync2i1 UTSW 12 116,171,335 (GRCm39) missense probably damaging 1.00
R4664:Dync2i1 UTSW 12 116,219,831 (GRCm39) missense probably damaging 0.99
R4954:Dync2i1 UTSW 12 116,219,645 (GRCm39) missense probably damaging 1.00
R5057:Dync2i1 UTSW 12 116,177,033 (GRCm39) missense probably benign 0.43
R5163:Dync2i1 UTSW 12 116,219,486 (GRCm39) missense possibly damaging 0.76
R5341:Dync2i1 UTSW 12 116,219,534 (GRCm39) missense possibly damaging 0.51
R5560:Dync2i1 UTSW 12 116,181,733 (GRCm39) missense probably damaging 0.98
R5870:Dync2i1 UTSW 12 116,219,865 (GRCm39) missense possibly damaging 0.94
R5925:Dync2i1 UTSW 12 116,197,014 (GRCm39) missense possibly damaging 0.82
R6223:Dync2i1 UTSW 12 116,221,078 (GRCm39) missense possibly damaging 0.95
R6364:Dync2i1 UTSW 12 116,205,352 (GRCm39) missense probably damaging 1.00
R6450:Dync2i1 UTSW 12 116,210,347 (GRCm39) nonsense probably null
R6462:Dync2i1 UTSW 12 116,193,251 (GRCm39) missense probably benign
R6751:Dync2i1 UTSW 12 116,177,076 (GRCm39) missense possibly damaging 0.52
R6896:Dync2i1 UTSW 12 116,193,291 (GRCm39) missense possibly damaging 0.52
R6962:Dync2i1 UTSW 12 116,175,398 (GRCm39) missense probably damaging 1.00
R7033:Dync2i1 UTSW 12 116,175,511 (GRCm39) missense probably benign 0.03
R7042:Dync2i1 UTSW 12 116,218,061 (GRCm39) missense probably benign 0.02
R7254:Dync2i1 UTSW 12 116,226,205 (GRCm39) intron probably benign
R7567:Dync2i1 UTSW 12 116,218,130 (GRCm39) splice site probably null
R7889:Dync2i1 UTSW 12 116,219,559 (GRCm39) nonsense probably null
R8082:Dync2i1 UTSW 12 116,177,127 (GRCm39) critical splice acceptor site probably null
R8288:Dync2i1 UTSW 12 116,177,345 (GRCm39) missense probably damaging 1.00
R8309:Dync2i1 UTSW 12 116,219,705 (GRCm39) missense probably damaging 1.00
R8682:Dync2i1 UTSW 12 116,188,610 (GRCm39) missense probably damaging 1.00
R8683:Dync2i1 UTSW 12 116,193,262 (GRCm39) missense probably benign 0.03
R8699:Dync2i1 UTSW 12 116,171,321 (GRCm39) missense probably benign 0.01
R8782:Dync2i1 UTSW 12 116,205,332 (GRCm39) missense probably damaging 1.00
R8809:Dync2i1 UTSW 12 116,193,234 (GRCm39) missense probably damaging 0.98
R9281:Dync2i1 UTSW 12 116,211,677 (GRCm39) nonsense probably null
R9530:Dync2i1 UTSW 12 116,175,411 (GRCm39) missense possibly damaging 0.87
R9751:Dync2i1 UTSW 12 116,205,403 (GRCm39) critical splice acceptor site probably null
V7581:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7582:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
V7583:Dync2i1 UTSW 12 116,175,460 (GRCm39) missense possibly damaging 0.73
X0063:Dync2i1 UTSW 12 116,219,489 (GRCm39) missense probably benign
Z1177:Dync2i1 UTSW 12 116,209,719 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CTGTAATCAAGTCTCATGTACCCATC -3'
(R):5'- TTTCATGGATCTGCCCAGACC -3'

Sequencing Primer
(F):5'- TCATTCTCCCGACACCAAGTC -3'
(R):5'- GCTGGCCTTGAACTCAGAAATCTG -3'
Posted On 2014-06-23