Incidental Mutation 'R1833:Idh1'
ID204912
Institutional Source Beutler Lab
Gene Symbol Idh1
Ensembl Gene ENSMUSG00000025950
Gene Nameisocitrate dehydrogenase 1 (NADP+), soluble
SynonymsId-1, Idh-1, IDPc, E030024J03Rik
MMRRC Submission 039860-MU
Accession Numbers

Genbank: NM_001111320, NM_010497 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65158616-65186500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65161114 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 364 (I364V)
Ref Sequence ENSEMBL: ENSMUSP00000127307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097709] [ENSMUST00000169032]
Predicted Effect probably benign
Transcript: ENSMUST00000097709
AA Change: I364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000095316
Gene: ENSMUSG00000025950
AA Change: I364V

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169032
AA Change: I364V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000127307
Gene: ENSMUSG00000025950
AA Change: I364V

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Electrophoretic variation has been shown in tissues of liver, kidney, spleen and muscle. Strains C57BL/6, C3H/He carry the a allele; DBA/2 carries the b allele; M.m. castaneus and M.m. molossinus carry the c allele; the d allele is found at low frequencyin M. m. molossinus in Japan. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, other(3) Gene trapped(11)

Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Idh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Idh1 APN 1 65166243 missense probably damaging 1.00
IGL00790:Idh1 APN 1 65166122 missense possibly damaging 0.94
IGL00979:Idh1 APN 1 65171149 missense probably damaging 1.00
IGL01397:Idh1 APN 1 65168595 missense possibly damaging 0.62
IGL02226:Idh1 APN 1 65161922 missense probably damaging 1.00
IGL02933:Idh1 APN 1 65161913 missense probably damaging 1.00
B5639:Idh1 UTSW 1 65165098 critical splice donor site probably null
R0310:Idh1 UTSW 1 65161920 missense probably damaging 1.00
R0865:Idh1 UTSW 1 65161156 missense probably benign
R1172:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1173:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1174:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1535:Idh1 UTSW 1 65168538 missense probably damaging 1.00
R2135:Idh1 UTSW 1 65161919 missense probably damaging 1.00
R5434:Idh1 UTSW 1 65175336 missense probably benign 0.00
R5478:Idh1 UTSW 1 65161838 missense probably benign 0.04
R5633:Idh1 UTSW 1 65165136 missense probably damaging 1.00
R6152:Idh1 UTSW 1 65159530 missense probably damaging 1.00
R6249:Idh1 UTSW 1 65166219 missense probably damaging 1.00
R6252:Idh1 UTSW 1 65168531 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGTCTACCTGATACCACACAC -3'
(R):5'- TTCATAACCCCTAATGATGCCCATC -3'

Sequencing Primer
(F):5'- GGTCTACCTGATACCACACACTACAC -3'
(R):5'- CATCTCTAGAAAGAGTGAAACACTAG -3'
Posted On2014-06-23