Incidental Mutation 'R1833:Trp53bp2'
ID204917
Institutional Source Beutler Lab
Gene Symbol Trp53bp2
Ensembl Gene ENSMUSG00000026510
Gene Nametransformation related protein 53 binding protein 2
Synonyms53BP2, ASPP2
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location182409172-182462432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 182429016 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 50 (H50Q)
Ref Sequence ENSEMBL: ENSMUSP00000112508 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117245]
Predicted Effect probably damaging
Transcript: ENSMUST00000117245
AA Change: H50Q

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112508
Gene: ENSMUSG00000026510
AA Change: H50Q

DomainStartEndE-ValueType
PDB:2UWQ|A 4 89 1e-53 PDB
Blast:RA 10 91 7e-50 BLAST
coiled coil region 129 306 N/A INTRINSIC
low complexity region 401 412 N/A INTRINSIC
low complexity region 495 512 N/A INTRINSIC
PDB:4IRV|H 728 788 5e-25 PDB
low complexity region 865 890 N/A INTRINSIC
ANK 964 993 2.52e-6 SMART
ANK 997 1026 7.13e-6 SMART
SH3 1066 1124 6.2e-13 SMART
Meta Mutation Damage Score 0.148 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ASPP (apoptosis-stimulating protein of p53) family of p53 interacting proteins. The protein contains four ankyrin repeats and an SH3 domain involved in protein-protein interactions. It is localized to the perinuclear region of the cytoplasm, and regulates apoptosis and cell growth through interactions with other regulatory molecules including members of the p53 family. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation is lethal by 30 days of age, although majority die embryonically. Heterozygotes show increased susceptibility to spontaneous and induced tumors of the lymphoma and sarcoma types [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Trp53bp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Trp53bp2 APN 1 182440976 missense probably benign 0.17
IGL00920:Trp53bp2 APN 1 182444654 unclassified probably benign
IGL01336:Trp53bp2 APN 1 182431583 missense probably damaging 1.00
IGL01760:Trp53bp2 APN 1 182448428 missense possibly damaging 0.68
IGL02539:Trp53bp2 APN 1 182448691 missense probably damaging 0.99
IGL02609:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02720:Trp53bp2 APN 1 182453724 missense probably benign 0.21
IGL02962:Trp53bp2 APN 1 182431595 missense probably benign 0.00
IGL03348:Trp53bp2 APN 1 182453748 missense probably damaging 1.00
Nosa UTSW 1 182455740 missense probably damaging 1.00
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0012:Trp53bp2 UTSW 1 182444718 missense probably damaging 0.99
R0347:Trp53bp2 UTSW 1 182441648 missense probably benign 0.08
R1422:Trp53bp2 UTSW 1 182446464 missense probably benign
R1845:Trp53bp2 UTSW 1 182458903 missense probably damaging 1.00
R1893:Trp53bp2 UTSW 1 182431628 missense probably benign 0.01
R1927:Trp53bp2 UTSW 1 182452664 missense probably damaging 0.98
R2017:Trp53bp2 UTSW 1 182449015 missense probably benign
R2020:Trp53bp2 UTSW 1 182442819 missense probably damaging 1.00
R2072:Trp53bp2 UTSW 1 182458867 missense probably benign 0.00
R2120:Trp53bp2 UTSW 1 182441639 missense probably benign 0.06
R2504:Trp53bp2 UTSW 1 182441639 missense probably benign 0.26
R2970:Trp53bp2 UTSW 1 182431598 missense probably damaging 1.00
R3051:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3052:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3053:Trp53bp2 UTSW 1 182453782 missense probably damaging 0.96
R3151:Trp53bp2 UTSW 1 182428960 missense probably damaging 1.00
R4043:Trp53bp2 UTSW 1 182449061 missense possibly damaging 0.93
R4757:Trp53bp2 UTSW 1 182458774 missense probably benign 0.04
R4785:Trp53bp2 UTSW 1 182448997 missense probably benign
R4817:Trp53bp2 UTSW 1 182441805 critical splice donor site probably null
R4836:Trp53bp2 UTSW 1 182431582 missense probably damaging 1.00
R5040:Trp53bp2 UTSW 1 182444706 missense probably damaging 1.00
R5882:Trp53bp2 UTSW 1 182442212 missense possibly damaging 0.87
R6007:Trp53bp2 UTSW 1 182455740 missense probably damaging 1.00
R6356:Trp53bp2 UTSW 1 182448997 missense probably benign
R6886:Trp53bp2 UTSW 1 182429043 critical splice donor site probably null
R6987:Trp53bp2 UTSW 1 182446635 missense probably damaging 0.99
R7026:Trp53bp2 UTSW 1 182442735 missense probably benign
R7141:Trp53bp2 UTSW 1 182448508 missense
Predicted Primers PCR Primer
(F):5'- TCTAAGGGGAATGCCACCTG -3'
(R):5'- TCCAACACACTTGTCACCTG -3'

Sequencing Primer
(F):5'- CCACCTGGGCAGACAAG -3'
(R):5'- GTTCAGTGACTTCCTTCTGTTACAG -3'
Posted On2014-06-23