Incidental Mutation 'R1833:Olfr1258'
ID204921
Institutional Source Beutler Lab
Gene Symbol Olfr1258
Ensembl Gene ENSMUSG00000049149
Gene Nameolfactory receptor 1258
SynonymsGA_x6K02T2Q125-51361752-51362687, MOR232-3
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location89927309-89936334 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 89930301 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 164 (L164*)
Ref Sequence ENSEMBL: ENSMUSP00000149547 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102609] [ENSMUST00000111516] [ENSMUST00000213720]
Predicted Effect probably null
Transcript: ENSMUST00000102609
AA Change: L164*
SMART Domains Protein: ENSMUSP00000099669
Gene: ENSMUSG00000049149
AA Change: L164*

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 2.6e-52 PFAM
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 6.4e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111516
AA Change: L164*
SMART Domains Protein: ENSMUSP00000107141
Gene: ENSMUSG00000049149
AA Change: L164*

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 33 299 3.4e-5 PFAM
Pfam:7tm_1 39 285 4.9e-32 PFAM
Pfam:7tm_4 137 278 2.7e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213720
AA Change: L164*
Meta Mutation Damage Score 0.6592 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Olfr1258
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02386:Olfr1258 APN 2 89930544 missense probably damaging 0.96
IGL02552:Olfr1258 APN 2 89930559 missense probably benign 0.01
IGL03300:Olfr1258 APN 2 89930227 nonsense probably null
R0081:Olfr1258 UTSW 2 89930079 missense possibly damaging 0.90
R0197:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0701:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R0883:Olfr1258 UTSW 2 89930201 missense probably benign 0.00
R1163:Olfr1258 UTSW 2 89930105 missense possibly damaging 0.78
R1846:Olfr1258 UTSW 2 89930666 missense possibly damaging 0.45
R4504:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4507:Olfr1258 UTSW 2 89930351 missense possibly damaging 0.89
R4679:Olfr1258 UTSW 2 89930664 missense possibly damaging 0.63
R4908:Olfr1258 UTSW 2 89930579 missense probably benign 0.00
R5430:Olfr1258 UTSW 2 89929913 missense probably benign 0.00
R6836:Olfr1258 UTSW 2 89930339 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATGACCCAGGTCTTTGG -3'
(R):5'- GCACTGTGGTTTCTTAATGAACGTAG -3'

Sequencing Primer
(F):5'- CCAGGTCTTTGGGGAGCATTTC -3'
(R):5'- GGTTTCTTAATGAACGTAGAATGACC -3'
Posted On2014-06-23