Incidental Mutation 'R1833:Mgam'
ID204943
Institutional Source Beutler Lab
Gene Symbol Mgam
Ensembl Gene ENSMUSG00000068587
Gene Namemaltase-glucoamylase
Synonyms6030407P20Rik
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location40628831-40769123 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 40654718 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000144652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202636]
Predicted Effect probably null
Transcript: ENSMUST00000071535
SMART Domains Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000201148
SMART Domains Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
low complexity region 47 59 N/A INTRINSIC
PD 63 111 1.81e-8 SMART
Pfam:NtCtMGAM_N 124 233 6.2e-36 PFAM
Pfam:Glyco_hydro_31 323 795 3.4e-145 PFAM
PD 924 977 4.52e-9 SMART
Pfam:NtCtMGAM_N 988 1101 1.5e-30 PFAM
Blast:ANK 1141 1171 1e-7 BLAST
Pfam:Glyco_hydro_31 1189 1691 2e-139 PFAM
low complexity region 1776 1791 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000202636
SMART Domains Protein: ENSMUSP00000144652
Gene: ENSMUSG00000068587

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
Pfam:Trefoil 28 70 3.6e-12 PFAM
Pfam:NtCtMGAM_N 87 196 1.4e-36 PFAM
Meta Mutation Damage Score 0.532 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Mgam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Mgam APN 6 40643010 missense probably benign
IGL01065:Mgam APN 6 40662710 critical splice donor site probably null
IGL01402:Mgam APN 6 40644945 missense probably benign 0.01
IGL01404:Mgam APN 6 40644945 missense probably benign 0.01
IGL01413:Mgam APN 6 40661277 missense probably damaging 1.00
IGL01546:Mgam APN 6 40654693 missense probably damaging 0.98
IGL01596:Mgam APN 6 40658270 missense probably damaging 1.00
IGL02133:Mgam APN 6 40643076 missense probably damaging 0.98
IGL02734:Mgam APN 6 40662694 missense probably damaging 1.00
R0012:Mgam UTSW 6 40765256 splice site probably null
R0116:Mgam UTSW 6 40658987 missense probably damaging 1.00
R0310:Mgam UTSW 6 40761035 splice site probably benign
R0452:Mgam UTSW 6 40759090 missense probably damaging 1.00
R0497:Mgam UTSW 6 40664892 missense probably damaging 1.00
R0699:Mgam UTSW 6 40643019 missense possibly damaging 0.84
R0738:Mgam UTSW 6 40754935 missense probably benign 0.01
R1033:Mgam UTSW 6 40680624 missense probably benign 0.07
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1403:Mgam UTSW 6 40666881 missense possibly damaging 0.93
R1430:Mgam UTSW 6 40756371 missense probably benign 0.08
R1432:Mgam UTSW 6 40756367 missense probably damaging 1.00
R1443:Mgam UTSW 6 40759780 nonsense probably null
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1470:Mgam UTSW 6 40759128 missense probably damaging 1.00
R1519:Mgam UTSW 6 40661683 missense probably benign 0.45
R1654:Mgam UTSW 6 40757487 missense probably damaging 1.00
R1667:Mgam UTSW 6 40677044 missense possibly damaging 0.62
R1730:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1781:Mgam UTSW 6 40669863 missense probably damaging 1.00
R1783:Mgam UTSW 6 40664860 missense possibly damaging 0.92
R1829:Mgam UTSW 6 40666892 missense probably damaging 1.00
R1872:Mgam UTSW 6 40661300 nonsense probably null
R1912:Mgam UTSW 6 40764185 nonsense probably null
R1977:Mgam UTSW 6 40664880 missense probably benign 0.01
R2048:Mgam UTSW 6 40656429 missense possibly damaging 0.80
R2086:Mgam UTSW 6 40761028 splice site probably null
R2138:Mgam UTSW 6 40756450 missense probably damaging 1.00
R2224:Mgam UTSW 6 40764274 unclassified probably null
R2408:Mgam UTSW 6 40686522 missense probably damaging 1.00
R2508:Mgam UTSW 6 40759783 missense probably damaging 1.00
R2842:Mgam UTSW 6 40661345 missense probably benign 0.01
R2847:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2848:Mgam UTSW 6 40652715 missense possibly damaging 0.67
R2965:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R2966:Mgam UTSW 6 40768220 missense possibly damaging 0.46
R3035:Mgam UTSW 6 40663530 missense probably benign
R3895:Mgam UTSW 6 40759120 missense probably damaging 1.00
R4027:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4030:Mgam UTSW 6 40754902 missense probably damaging 1.00
R4302:Mgam UTSW 6 40763085 missense probably benign 0.02
R4707:Mgam UTSW 6 40714632 intron probably null
R4826:Mgam UTSW 6 40680648 missense possibly damaging 0.52
R4898:Mgam UTSW 6 40643054 missense probably benign
R5438:Mgam UTSW 6 40684521 missense probably damaging 1.00
R5492:Mgam UTSW 6 40756363 missense probably damaging 1.00
R5770:Mgam UTSW 6 40669804 missense probably benign 0.01
R5839:Mgam UTSW 6 40740064 missense possibly damaging 0.90
R5845:Mgam UTSW 6 40675323 missense possibly damaging 0.78
R5847:Mgam UTSW 6 40684055 missense probably benign 0.42
R5891:Mgam UTSW 6 40744348 missense probably benign
R6158:Mgam UTSW 6 40757714 missense probably damaging 1.00
R6193:Mgam UTSW 6 40747920 nonsense probably null
R6423:Mgam UTSW 6 40677045 missense possibly damaging 0.84
R6706:Mgam UTSW 6 40744786 missense probably benign 0.00
R6813:Mgam UTSW 6 40750165 missense probably damaging 0.99
R6863:Mgam UTSW 6 40729009 missense probably benign 0.00
R6906:Mgam UTSW 6 40747919 missense probably damaging 1.00
R7091:Mgam UTSW 6 40768276 missense possibly damaging 0.95
R7099:Mgam UTSW 6 40661716 missense probably benign 0.09
R7282:Mgam UTSW 6 40656512 missense possibly damaging 0.71
R7282:Mgam UTSW 6 40763111 missense probably benign
R7354:Mgam UTSW 6 40744798 missense probably damaging 1.00
R7374:Mgam UTSW 6 40757439 missense possibly damaging 0.89
R7399:Mgam UTSW 6 40666854 missense probably damaging 0.99
R7406:Mgam UTSW 6 40663525 missense probably benign 0.13
R7446:Mgam UTSW 6 40746332 missense probably damaging 1.00
R7466:Mgam UTSW 6 40744789 missense probably benign 0.00
X0021:Mgam UTSW 6 40659047 missense probably damaging 1.00
Z1088:Mgam UTSW 6 40643060 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCTCTGCCCCTTTGACCAAAAG -3'
(R):5'- AACCTGTGGCACCATCTTG -3'

Sequencing Primer
(F):5'- TAGGATTCACAGCCACAC -3'
(R):5'- CTCCATGGTATCTATGACAAATGAG -3'
Posted On2014-06-23