Incidental Mutation 'R1833:Nectin2'
ID204953
Institutional Source Beutler Lab
Gene Symbol Nectin2
Ensembl Gene ENSMUSG00000062300
Gene Namenectin cell adhesion molecule 2
SynonymsMPH, nectin-2, Cd112, Pvs, Pvrl2
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location19716644-19750483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19717708 bp
ZygosityHeterozygous
Amino Acid Change Proline to Histidine at position 467 (P467H)
Ref Sequence ENSEMBL: ENSMUSP00000074898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032555] [ENSMUST00000075447] [ENSMUST00000093552]
PDB Structure
Crystal structure of mouse nectin-2 extracellular fragment D1-D2 [X-RAY DIFFRACTION]
Crystal structure of mouse nectin-2 extracellular fragment D1-D2, 2nd crystal form [X-RAY DIFFRACTION]
Crystal structure of mutant F136D of mouse nectin-2 extracellular fragment D1-D2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000032555
SMART Domains Protein: ENSMUSP00000032555
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 7.7e-85 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000075447
AA Change: P467H

PolyPhen 2 Score 0.960 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000074898
Gene: ENSMUSG00000062300
AA Change: P467H

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
IGv 49 133 3.59e-14 SMART
IG_like 159 249 5.31e1 SMART
IG_like 261 338 8.12e1 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
low complexity region 486 496 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093552
SMART Domains Protein: ENSMUSP00000104090
Gene: ENSMUSG00000002984

DomainStartEndE-ValueType
low complexity region 8 69 N/A INTRINSIC
Pfam:Porin_3 79 355 1.5e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172483
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173966
Meta Mutation Damage Score 0.0336 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a single-pass type I membrane glycoprotein with two Ig-like C2-type domains and an Ig-like V-type domain. This protein is one of the plasma membrane components of adherens junctions. It also serves as an entry for certain mutant strains of herpes simplex virus and pseudorabies virus, and it is involved in cell to cell spreading of these viruses. Variations in this gene have been associated with differences in the severity of multiple sclerosis. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted null mutations exhibit male sterility associated with sperm head and midpiece malformation, impaired zona binding, and lack of oocyte penetration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Nectin2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Nectin2 APN 7 19717562 missense probably damaging 1.00
IGL03184:Nectin2 APN 7 19738306 missense possibly damaging 0.86
PIT4458001:Nectin2 UTSW 7 19738327 missense probably benign 0.19
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0012:Nectin2 UTSW 7 19730744 splice site probably benign
R0555:Nectin2 UTSW 7 19733223 splice site probably benign
R0764:Nectin2 UTSW 7 19749171 intron probably null
R1252:Nectin2 UTSW 7 19717598 missense probably benign 0.18
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R1465:Nectin2 UTSW 7 19730116 missense probably benign
R2115:Nectin2 UTSW 7 19717564 missense probably damaging 0.98
R2168:Nectin2 UTSW 7 19730614 missense probably damaging 0.98
R3801:Nectin2 UTSW 7 19717636 missense probably benign
R3825:Nectin2 UTSW 7 19724585 missense possibly damaging 0.94
R4877:Nectin2 UTSW 7 19717720 missense possibly damaging 0.55
R5062:Nectin2 UTSW 7 19738273 missense probably benign 0.09
R5082:Nectin2 UTSW 7 19738124 missense probably damaging 0.99
R5693:Nectin2 UTSW 7 19724869 missense probably benign 0.00
R6042:Nectin2 UTSW 7 19738138 missense probably benign 0.01
R6060:Nectin2 UTSW 7 19717775 missense probably damaging 1.00
R6657:Nectin2 UTSW 7 19738140 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- ACATACATGGCCCGTGACAC -3'
(R):5'- CTGTACAGAGAAGTTTGGTCGAG -3'

Sequencing Primer
(F):5'- AGGAAGTCTTCCTCCTCA -3'
(R):5'- AAAGGATGGCAGTGGTGTAGTTG -3'
Posted On2014-06-23