Incidental Mutation 'R1833:Tgfb1i1'
ID204958
Institutional Source Beutler Lab
Gene Symbol Tgfb1i1
Ensembl Gene ENSMUSG00000030782
Gene Nametransforming growth factor beta 1 induced transcript 1
SynonymsARA55, TSC-5, hic-5
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1833 (G1)
Quality Score207
Status Validated
Chromosome7
Chromosomal Location128246812-128255699 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 128249498 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129958 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044660] [ENSMUST00000070656] [ENSMUST00000163609] [ENSMUST00000164710] [ENSMUST00000165667] [ENSMUST00000167965] [ENSMUST00000169919] [ENSMUST00000170115]
Predicted Effect probably benign
Transcript: ENSMUST00000044660
SMART Domains Protein: ENSMUSP00000040568
Gene: ENSMUSG00000042178

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 62 104 N/A INTRINSIC
ARM 137 179 2.89e-1 SMART
ARM 180 221 3.32e-1 SMART
ARM 222 263 2.93e-2 SMART
Blast:ARM 265 306 1e-8 BLAST
low complexity region 313 338 N/A INTRINSIC
ARM 353 399 4.88e0 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 670 690 N/A INTRINSIC
Pfam:BTB 742 854 9.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000070656
SMART Domains Protein: ENSMUSP00000068529
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 19 183 1.7e-7 PFAM
LIM 210 261 5.18e-22 SMART
LIM 269 320 4.37e-20 SMART
LIM 328 379 3.69e-18 SMART
LIM 387 438 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163553
Predicted Effect probably benign
Transcript: ENSMUST00000163609
SMART Domains Protein: ENSMUSP00000133134
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 11 44 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
LIM 116 167 5.18e-22 SMART
LIM 175 226 4.37e-20 SMART
LIM 234 285 3.69e-18 SMART
LIM 293 344 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164710
SMART Domains Protein: ENSMUSP00000130964
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 28 48 N/A INTRINSIC
Pfam:Paxillin 49 178 1.4e-10 PFAM
low complexity region 197 209 N/A INTRINSIC
LIM 249 300 5.18e-22 SMART
LIM 308 359 4.37e-20 SMART
LIM 367 418 3.69e-18 SMART
LIM 426 477 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000165667
SMART Domains Protein: ENSMUSP00000127695
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 27 37 N/A INTRINSIC
low complexity region 83 116 N/A INTRINSIC
low complexity region 136 148 N/A INTRINSIC
LIM 188 239 5.18e-22 SMART
LIM 247 298 4.37e-20 SMART
LIM 306 357 3.69e-18 SMART
LIM 365 416 6.89e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166755
Predicted Effect probably benign
Transcript: ENSMUST00000167965
SMART Domains Protein: ENSMUSP00000132100
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 34 200 7.3e-8 PFAM
LIM 227 278 5.18e-22 SMART
LIM 286 337 4.37e-20 SMART
LIM 345 396 3.69e-18 SMART
LIM 404 455 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168825
SMART Domains Protein: ENSMUSP00000132685
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 76 92 N/A INTRINSIC
low complexity region 113 125 N/A INTRINSIC
LIM 165 216 5.18e-22 SMART
LIM 224 275 4.37e-20 SMART
LIM 283 334 3.69e-18 SMART
LIM 342 393 6.89e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169919
SMART Domains Protein: ENSMUSP00000131705
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
low complexity region 24 37 N/A INTRINSIC
low complexity region 44 54 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170115
SMART Domains Protein: ENSMUSP00000129958
Gene: ENSMUSG00000030782

DomainStartEndE-ValueType
Pfam:Paxillin 17 112 1.9e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205654
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206691
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coactivator of the androgen receptor, a transcription factor which is activated by androgen and has a key role in male sexual differentiation. The encoded protein is thought to regulate androgen receptor activity and may have a role to play in the treatment of prostate cancer. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal response to wire injury of femoral arteries and increased VSMC apoptosis in response to wire injury or mechanical stress. Mice homozygous for a different knock-out allele show normal platelet integrin function both in vitro and in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Tgfb1i1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Tgfb1i1 APN 7 128252521 missense probably damaging 1.00
IGL01919:Tgfb1i1 APN 7 128248482 splice site probably benign
IGL01996:Tgfb1i1 APN 7 128249292 splice site probably benign
IGL02527:Tgfb1i1 APN 7 128252562 splice site probably benign
IGL02596:Tgfb1i1 APN 7 128248896 start codon destroyed probably null 0.05
IGL03139:Tgfb1i1 APN 7 128249304 missense possibly damaging 0.79
R0114:Tgfb1i1 UTSW 7 128249494 missense probably damaging 1.00
R2116:Tgfb1i1 UTSW 7 128252805 missense probably damaging 1.00
R2508:Tgfb1i1 UTSW 7 128248913 unclassified probably null
R4695:Tgfb1i1 UTSW 7 128249176 missense probably damaging 1.00
R4756:Tgfb1i1 UTSW 7 128249399 missense probably damaging 1.00
R4853:Tgfb1i1 UTSW 7 128248668 nonsense probably null
R5024:Tgfb1i1 UTSW 7 128248217 start codon destroyed probably null 0.33
R5770:Tgfb1i1 UTSW 7 128248547 intron probably benign
R5839:Tgfb1i1 UTSW 7 128253365 makesense probably null
R6105:Tgfb1i1 UTSW 7 128248417 splice site probably null
R6178:Tgfb1i1 UTSW 7 128253345 missense probably damaging 0.98
R6310:Tgfb1i1 UTSW 7 128252837 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCGTGATGCTTCCAGTCTG -3'
(R):5'- CACTTTGTATCTAACCTGTACATGC -3'

Sequencing Primer
(F):5'- ACTGCAGCTTCCAGCCTCAG -3'
(R):5'- AGACAGGGTTTCTCTGTATAGCCC -3'
Posted On2014-06-23