Incidental Mutation 'R1833:Hephl1'
ID204964
Institutional Source Beutler Lab
Gene Symbol Hephl1
Ensembl Gene ENSMUSG00000031936
Gene Namehephaestin-like 1
SynonymsLOC244698, zyklopen, Zp
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location15051841-15112108 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15076928 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 628 (Y628C)
Ref Sequence ENSEMBL: ENSMUSP00000124518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159985]
Predicted Effect probably damaging
Transcript: ENSMUST00000159985
AA Change: Y628C

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000124518
Gene: ENSMUSG00000031936
AA Change: Y628C

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
Pfam:Cu-oxidase_3 97 209 2.8e-12 PFAM
Pfam:Cu-oxidase_2 289 365 2.4e-9 PFAM
Pfam:Cu-oxidase_3 452 564 1.2e-9 PFAM
Blast:FA58C 604 703 9e-9 BLAST
Pfam:Cu-oxidase_3 805 908 1.6e-7 PFAM
Pfam:Cu-oxidase_2 946 1067 9e-14 PFAM
transmembrane domain 1115 1137 N/A INTRINSIC
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ccr1 T A 9: 123,964,089 I135F probably damaging Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Hephl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00979:Hephl1 APN 9 15067045 missense probably benign 0.06
IGL01105:Hephl1 APN 9 15089024 missense possibly damaging 0.95
IGL01731:Hephl1 APN 9 15069770 missense probably damaging 1.00
IGL02010:Hephl1 APN 9 15090556 nonsense probably null
IGL02112:Hephl1 APN 9 15081815 splice site probably benign
IGL02227:Hephl1 APN 9 15069793 missense probably damaging 1.00
IGL02490:Hephl1 APN 9 15053685 missense probably benign 0.06
IGL02960:Hephl1 APN 9 15084319 missense probably damaging 1.00
IGL03265:Hephl1 APN 9 15060959 missense probably benign 0.14
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0006:Hephl1 UTSW 9 15076764 missense probably benign 0.16
R0007:Hephl1 UTSW 9 15086175 missense possibly damaging 0.58
R0092:Hephl1 UTSW 9 15090603 frame shift probably null
R0421:Hephl1 UTSW 9 15059160 missense probably benign 0.05
R0448:Hephl1 UTSW 9 15076926 missense probably damaging 1.00
R0563:Hephl1 UTSW 9 15081945 missense probably damaging 1.00
R0602:Hephl1 UTSW 9 15089051 missense probably damaging 0.99
R0631:Hephl1 UTSW 9 15084524 missense probably benign 0.04
R0747:Hephl1 UTSW 9 15054001 splice site probably benign
R1123:Hephl1 UTSW 9 15080140 missense probably benign 0.00
R1386:Hephl1 UTSW 9 15076754 missense probably benign
R1711:Hephl1 UTSW 9 15059246 missense probably damaging 1.00
R1743:Hephl1 UTSW 9 15090068 missense probably damaging 0.99
R1908:Hephl1 UTSW 9 15074124 nonsense probably null
R1918:Hephl1 UTSW 9 15076818 missense probably benign 0.16
R1938:Hephl1 UTSW 9 15053987 missense possibly damaging 0.88
R1986:Hephl1 UTSW 9 15054552 missense probably damaging 1.00
R3122:Hephl1 UTSW 9 15088969 missense possibly damaging 0.90
R3832:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R3833:Hephl1 UTSW 9 15069748 missense probably damaging 1.00
R4280:Hephl1 UTSW 9 15112034 missense probably benign 0.05
R4434:Hephl1 UTSW 9 15076796 missense probably damaging 0.99
R4790:Hephl1 UTSW 9 15059171 missense probably damaging 1.00
R4793:Hephl1 UTSW 9 15097990 missense probably benign 0.34
R4960:Hephl1 UTSW 9 15086290 missense probably damaging 1.00
R5125:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5152:Hephl1 UTSW 9 15080185 missense probably damaging 1.00
R5178:Hephl1 UTSW 9 15086172 missense probably damaging 0.98
R5288:Hephl1 UTSW 9 15076854 missense possibly damaging 0.83
R5372:Hephl1 UTSW 9 15097899 nonsense probably null
R5377:Hephl1 UTSW 9 15069788 missense probably damaging 1.00
R5788:Hephl1 UTSW 9 15084283 missense possibly damaging 0.93
R5795:Hephl1 UTSW 9 15069760 missense probably damaging 0.99
R6210:Hephl1 UTSW 9 15090564 missense possibly damaging 0.57
R6303:Hephl1 UTSW 9 15090152 missense possibly damaging 0.69
R6394:Hephl1 UTSW 9 15074101 missense probably benign 0.00
R6653:Hephl1 UTSW 9 15081964 missense probably damaging 0.99
R6764:Hephl1 UTSW 9 15088921 missense possibly damaging 0.88
R7114:Hephl1 UTSW 9 15069815 missense probably damaging 0.96
R7143:Hephl1 UTSW 9 15060810 missense possibly damaging 0.80
R7404:Hephl1 UTSW 9 15069751 missense possibly damaging 0.84
R7446:Hephl1 UTSW 9 15098051 missense probably damaging 1.00
R7447:Hephl1 UTSW 9 15097882 critical splice donor site probably null
X0026:Hephl1 UTSW 9 15084228 critical splice donor site probably null
X0066:Hephl1 UTSW 9 15053668 missense probably benign 0.00
Z1088:Hephl1 UTSW 9 15053721 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGAATGGTCTGGCTGCATG -3'
(R):5'- TTGTTAGTTCTAGCCACCTTGTAGC -3'

Sequencing Primer
(F):5'- AGTCACGATGAGTCCCT -3'
(R):5'- AGCCACCTTGTAGCATTTTCTCTAG -3'
Posted On2014-06-23