Incidental Mutation 'R1833:Ccr1'
ID204970
Institutional Source Beutler Lab
Gene Symbol Ccr1
Ensembl Gene ENSMUSG00000025804
Gene Namechemokine (C-C motif) receptor 1
SynonymsCmkbr1
MMRRC Submission 039860-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R1833 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123962124-123968692 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 123964089 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 135 (I135F)
Ref Sequence ENSEMBL: ENSMUSP00000026911 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026911]
Predicted Effect probably damaging
Transcript: ENSMUST00000026911
AA Change: I135F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000026911
Gene: ENSMUSG00000025804
AA Change: I135F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 45 316 5.1e-8 PFAM
Pfam:7tm_1 51 301 8.5e-52 PFAM
Meta Mutation Damage Score 0.278 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. The ligands of this receptor include macrophage inflammatory protein 1 alpha (MIP-1 alpha), regulated on activation normal T expressed and secreted protein (RANTES), monocyte chemoattractant protein 3 (MCP-3), and myeloid progenitor inhibitory factor-1 (MPIF-1). Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. Knockout studies of the mouse homolog suggested the roles of this gene in host protection from inflammatory response, and susceptibility to virus and parasite. This gene and other chemokine receptor genes, including CCR2, CCRL2, CCR3, CCR5 and CCXCR1, are found to form a gene cluster on chromosome 3p. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit altered trafficking and proliferation of myeloid progenitor cells, and impairments in granulomatous inflammation of the lung and neutrophil associated host defense. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003H04Rik T A 3: 124,556,860 D143V unknown Het
4930438A08Rik C T 11: 58,288,388 Q183* probably null Het
9230009I02Rik A G 11: 51,091,466 noncoding transcript Het
Abhd12 T A 2: 150,848,418 D119V probably damaging Het
Adam1b A G 5: 121,502,937 I15T possibly damaging Het
Agtpbp1 A T 13: 59,465,983 probably null Het
Arfgef1 G C 1: 10,204,890 I312M probably benign Het
Arid4a C T 12: 71,075,466 L874F possibly damaging Het
Bcas3 G A 11: 85,583,949 V317I probably benign Het
Ces2h A G 8: 105,020,373 E547G possibly damaging Het
Ces3b T A 8: 105,085,639 D173E probably damaging Het
Chd3 A G 11: 69,354,123 L1197S probably damaging Het
Cngb1 A G 8: 95,242,355 L1175P probably damaging Het
Cyp4f17 T C 17: 32,524,210 F286L probably benign Het
Dclre1a C T 19: 56,541,500 probably null Het
Dennd6a T A 14: 26,606,954 L44H probably damaging Het
Dhx16 A G 17: 35,885,619 T560A probably benign Het
Dusp12 T C 1: 170,874,453 M326V probably benign Het
Eif3k T C 7: 28,971,427 I180V probably benign Het
Erc1 A G 6: 119,743,429 I437T possibly damaging Het
Fam71d G A 12: 78,715,506 probably benign Het
Farp2 T A 1: 93,576,364 probably benign Het
Foxa3 A G 7: 19,014,574 L209P probably damaging Het
Gen1 A T 12: 11,248,351 probably benign Het
Gm10305 A G 4: 99,273,126 T91A unknown Het
Gm10436 T C 12: 88,178,448 E44G possibly damaging Het
Gm14412 T C 2: 177,315,790 D104G probably benign Het
Gm340 T C 19: 41,584,948 I714T probably benign Het
Gm6900 T C 7: 10,656,588 noncoding transcript Het
Gpx1 A T 9: 108,339,356 Y15F possibly damaging Het
H2-M10.3 T C 17: 36,367,495 Y146C probably damaging Het
H2-Q7 C A 17: 35,439,699 S104R probably benign Het
Hephl1 T C 9: 15,076,928 Y628C probably damaging Het
Hspa5 T A 2: 34,776,053 Y636* probably null Het
Htt A G 5: 34,905,748 probably benign Het
Idh1 T C 1: 65,161,114 I364V probably benign Het
Itgae G T 11: 73,117,162 A423S possibly damaging Het
Kng2 T C 16: 23,012,052 N169S possibly damaging Het
Larp4b C T 13: 9,151,199 T369I possibly damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Magi2 G T 5: 19,227,457 G57C probably damaging Het
Mdn1 T A 4: 32,720,761 H2291Q probably damaging Het
Mgam T C 6: 40,654,718 probably null Het
Micall2 A G 5: 139,716,753 V245A probably benign Het
Mipep T G 14: 60,872,063 Y630D probably damaging Het
Msx2 A T 13: 53,468,185 M263K probably damaging Het
Nectin2 G T 7: 19,717,708 P467H probably damaging Het
Nek10 A T 14: 14,842,789 M165L probably benign Het
Nlrp4b A T 7: 10,725,936 M455L probably benign Het
Oaz3 TGGAGGCAGGAGCACGGGAGGCAGGAGCACGGGAGGCAG TGGAGGCAGGAGCACGGGAGGCAG 3: 94,436,042 probably benign Het
Olfr1258 T A 2: 89,930,301 L164* probably null Het
Olfr286 T A 15: 98,226,965 I227F probably damaging Het
Pcx T A 19: 4,619,104 V710E probably damaging Het
Pkn2 C T 3: 142,821,647 R347Q probably damaging Het
Qsox1 C T 1: 155,791,045 G233S probably benign Het
Rbl1 T A 2: 157,195,555 N224I probably damaging Het
Rspry1 A G 8: 94,635,488 T132A probably damaging Het
Sclt1 A G 3: 41,727,111 V91A probably damaging Het
Sema4f A T 6: 82,918,559 L331H probably benign Het
Sf3b3 T A 8: 110,817,566 Q814L probably benign Het
Slc19a2 T G 1: 164,262,184 Y190D probably damaging Het
Smarcc1 T A 9: 110,153,811 H204Q possibly damaging Het
Sox6 T C 7: 115,777,093 K135E probably damaging Het
Tecpr1 T C 5: 144,208,608 Q607R probably damaging Het
Tgfb1i1 A G 7: 128,249,498 probably benign Het
Tirap T G 9: 35,188,703 R228S probably benign Het
Tmem211 A G 5: 113,234,569 probably benign Het
Trp53bp2 T A 1: 182,429,016 H50Q probably damaging Het
Try4 A G 6: 41,303,431 H63R probably damaging Het
Vmn2r25 G A 6: 123,839,684 P313S probably benign Het
Vps26a A C 10: 62,459,046 L250V probably benign Het
Vwf A G 6: 125,642,037 H1226R probably benign Het
Wdtc1 TCC TC 4: 133,308,742 probably benign Het
Zc3hav1l A T 6: 38,297,946 probably benign Het
Zfp119b T G 17: 55,939,271 H305P probably damaging Het
Zfp326 C T 5: 105,891,169 Q134* probably null Het
Zfp975 C T 7: 42,661,839 R450Q probably benign Het
Zfyve26 A T 12: 79,286,258 M313K probably benign Het
Zscan5b T C 7: 6,238,966 S395P possibly damaging Het
Other mutations in Ccr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Ccr1 APN 9 123964053 missense probably benign 0.22
IGL00550:Ccr1 APN 9 123963636 missense probably damaging 1.00
IGL00934:Ccr1 APN 9 123963740 missense probably damaging 0.98
IGL01795:Ccr1 APN 9 123964112 nonsense probably null
IGL02447:Ccr1 APN 9 123963716 missense probably benign 0.01
PIT4431001:Ccr1 UTSW 9 123964194 missense probably benign
PIT4466001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
PIT4472001:Ccr1 UTSW 9 123963728 missense probably damaging 0.99
R0900:Ccr1 UTSW 9 123964334 missense possibly damaging 0.50
R0931:Ccr1 UTSW 9 123963790 missense probably damaging 1.00
R1165:Ccr1 UTSW 9 123963494 missense possibly damaging 0.51
R1386:Ccr1 UTSW 9 123963962 missense probably benign 0.05
R1513:Ccr1 UTSW 9 123964473 missense probably benign 0.00
R1615:Ccr1 UTSW 9 123963536 missense probably benign 0.00
R1996:Ccr1 UTSW 9 123963514 missense probably benign 0.41
R3833:Ccr1 UTSW 9 123964287 missense possibly damaging 0.74
R4085:Ccr1 UTSW 9 123963950 missense probably benign
R4545:Ccr1 UTSW 9 123964400 missense probably benign 0.11
R4745:Ccr1 UTSW 9 123963948 missense probably benign 0.05
R5369:Ccr1 UTSW 9 123964289 missense probably damaging 0.98
R5415:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R5416:Ccr1 UTSW 9 123964376 missense probably damaging 1.00
R6446:Ccr1 UTSW 9 123964106 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCTCTTGTAGGGGAAATG -3'
(R):5'- TCATGCAGCATAGGAGGCTTC -3'

Sequencing Primer
(F):5'- CTCTTGTAGGGGAAATGAGGGCTAC -3'
(R):5'- AGCATGACCAGCATCTACCTGTTC -3'
Posted On2014-06-23