Incidental Mutation 'R1834:Unc80'
ID205007
Institutional Source Beutler Lab
Gene Symbol Unc80
Ensembl Gene ENSMUSG00000055567
Gene Nameunc-80, NALCN activator
SynonymsC030018G13Rik, C230061B10Rik
MMRRC Submission 039861-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.921) question?
Stock #R1834 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location66468367-66699148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 66639248 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 2063 (T2063S)
Ref Sequence ENSEMBL: ENSMUSP00000053692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061620] [ENSMUST00000212557]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061620
AA Change: T2063S

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000053692
Gene: ENSMUSG00000055567
AA Change: T2063S

DomainStartEndE-ValueType
Pfam:UNC80 16 236 2.2e-94 PFAM
low complexity region 372 385 N/A INTRINSIC
low complexity region 493 502 N/A INTRINSIC
low complexity region 693 711 N/A INTRINSIC
low complexity region 723 738 N/A INTRINSIC
low complexity region 739 769 N/A INTRINSIC
low complexity region 1038 1055 N/A INTRINSIC
low complexity region 1067 1084 N/A INTRINSIC
low complexity region 1309 1328 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1676 1681 N/A INTRINSIC
low complexity region 1842 1848 N/A INTRINSIC
low complexity region 1854 1868 N/A INTRINSIC
low complexity region 2461 2480 N/A INTRINSIC
low complexity region 2726 2740 N/A INTRINSIC
low complexity region 3121 3144 N/A INTRINSIC
low complexity region 3245 3254 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000212557
AA Change: T1995S
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a voltage-independent 'leak' ion-channel complex, in which it performs essential functions, such as serving as a bridge between two other components (sodium leak channel non-selective and UNC79) and as a scaffold for Src kinases. Leak channels play an importnat role in establishment and maintenance of resting membrane potentials in neurons. Mutations in this gene are associated with congenital infantile encephalopathy, intellectual disability and growth issues. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,487 D20G probably damaging Het
2310061N02Rik T A 16: 88,707,898 S4C unknown Het
4933416C03Rik T C 10: 116,112,665 R319G probably benign Het
Abca3 A T 17: 24,376,692 N340Y probably benign Het
Abcc1 A G 16: 14,423,117 I513V possibly damaging Het
Acacb C T 5: 114,235,475 T1855M probably damaging Het
Ace A G 11: 105,986,094 probably benign Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adarb1 C A 10: 77,317,231 probably benign Het
Afm T A 5: 90,526,424 M265K probably benign Het
Agl A G 3: 116,788,351 F293S probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgap31 C A 16: 38,603,703 S667I probably benign Het
Bco1 A G 8: 117,117,437 T297A probably benign Het
Bmp1 T C 14: 70,508,831 S123G possibly damaging Het
Caps2 G A 10: 112,195,718 D283N possibly damaging Het
Ccdc57 A C 11: 120,861,219 S845R probably benign Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Chrna6 A G 8: 27,407,214 S212P probably benign Het
Col10a1 G C 10: 34,395,015 A328P probably damaging Het
Col4a2 A G 8: 11,402,997 E188G probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cttnbp2 C T 6: 18,501,966 V16M probably damaging Het
D430041D05Rik A G 2: 104,168,101 S1102P probably damaging Het
Ddx31 C T 2: 28,892,453 H603Y probably damaging Het
Ddx52 G A 11: 83,959,497 C568Y probably benign Het
Dgki C A 6: 37,034,701 probably benign Het
Dmrt1 A T 19: 25,509,699 Q123L probably damaging Het
Dnah5 A T 15: 28,409,124 M3563L probably benign Het
Dnah7b A T 1: 46,233,759 N2349I possibly damaging Het
Dscaml1 T G 9: 45,683,632 S678A probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Ece1 A G 4: 137,958,128 N643S probably damaging Het
Eno1b A G 18: 48,047,463 Y236C probably damaging Het
Esco1 T C 18: 10,594,350 E312G probably damaging Het
Eya3 T A 4: 132,707,118 V276E probably damaging Het
Fam161b A G 12: 84,348,778 probably benign Het
Fem1c C T 18: 46,505,282 G551D probably damaging Het
Fer1l6 T C 15: 58,557,869 I155T possibly damaging Het
Gbp7 A G 3: 142,534,680 Y53C probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10030 C T 9: 111,004,879 noncoding transcript Het
Gm1966 A T 7: 106,603,776 V87D possibly damaging Het
Gm3443 T A 19: 21,555,679 H2Q unknown Het
Gm5800 T C 14: 51,716,092 E22G possibly damaging Het
Gsdma2 G T 11: 98,649,079 R9L probably damaging Het
Ica1l A G 1: 60,028,236 probably benign Het
Ice1 G A 13: 70,615,338 T167I probably damaging Het
Ifi204 T A 1: 173,747,606 R618S unknown Het
Itga2 C A 13: 114,856,726 K784N probably damaging Het
Itga2 T A 13: 114,856,727 K784M probably damaging Het
Kif3b A G 2: 153,317,485 E402G probably benign Het
Lrp2 T C 2: 69,466,880 I3246V probably benign Het
Lrrn3 G T 12: 41,453,518 L267I probably damaging Het
Map1s A G 8: 70,916,411 Y868C probably damaging Het
Mcm5 A G 8: 75,119,273 T370A possibly damaging Het
Nat8f7 T C 6: 85,707,811 S16G probably benign Het
Nav3 T C 10: 109,720,022 T1683A probably damaging Het
Nbeal2 T C 9: 110,627,129 N2417S probably damaging Het
Neb T C 2: 52,236,895 N3605S probably damaging Het
Net1 A T 13: 3,912,941 probably benign Het
Nsd1 A G 13: 55,313,351 T2464A possibly damaging Het
Nt5e T A 9: 88,370,187 I534N probably damaging Het
Nudt12 T A 17: 59,011,076 H58L probably damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr291 A G 7: 84,856,482 T38A probably damaging Het
Olfr403 A G 11: 74,195,653 H50R probably benign Het
Olfr695 A G 7: 106,874,141 Y35H probably damaging Het
Olfr826 A G 10: 130,180,832 I16T probably benign Het
Pef1 C A 4: 130,121,173 C10* probably null Het
Phf21b A G 15: 84,797,346 Y256H probably damaging Het
Phox2a G T 7: 101,820,945 probably null Het
Pi16 A G 17: 29,327,445 E399G possibly damaging Het
Pipox A T 11: 77,882,123 Y321N probably damaging Het
Plin4 A G 17: 56,103,522 S1170P probably damaging Het
Pnma2 C T 14: 66,917,213 S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 I738T probably damaging Het
Prkcsh A T 9: 22,008,338 K188M probably damaging Het
Rcc1l A T 5: 134,163,659 Y309N probably damaging Het
Ripk1 A G 13: 34,015,213 T123A probably benign Het
Robo4 A G 9: 37,413,059 D961G probably benign Het
Rps27a A G 11: 29,546,299 Y105H probably benign Het
Scaper A G 9: 55,816,734 Y641H possibly damaging Het
Scn1a C A 2: 66,324,616 Q666H probably benign Het
Scn1a T A 2: 66,324,617 Q666L probably benign Het
Sdhaf4 T C 1: 24,003,153 probably null Het
Sec14l3 A G 11: 4,066,510 probably benign Het
Selp C A 1: 164,128,160 probably null Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Sptan1 T A 2: 29,992,001 probably benign Het
Sptbn4 T A 7: 27,366,646 E679V probably null Het
Sytl3 G A 17: 6,728,327 E169K probably benign Het
Taar1 T C 10: 23,921,189 C262R probably benign Het
Tbc1d32 A G 10: 56,017,604 I1291T probably benign Het
Tcrg-C3 A G 13: 19,263,365 T163A possibly damaging Het
Tet1 G A 10: 62,813,665 P89S probably damaging Het
Tgfbrap1 C A 1: 43,071,635 G7W probably damaging Het
Thada A G 17: 84,226,004 V1673A possibly damaging Het
Thbs4 A G 13: 92,761,481 V610A probably benign Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Tmem65 A T 15: 58,787,113 H200Q probably damaging Het
Trim62 T C 4: 128,909,225 V356A possibly damaging Het
Ttn T C 2: 76,732,158 D28781G probably damaging Het
Ttn C T 2: 76,763,260 V20679I probably benign Het
Vav3 A G 3: 109,506,426 T227A probably benign Het
Vmn2r118 A T 17: 55,592,456 I816N probably damaging Het
Vmn2r26 T A 6: 124,061,410 M648K possibly damaging Het
Vmn2r88 T G 14: 51,413,030 probably benign Het
Vwa3a A G 7: 120,790,136 T66A probably benign Het
Xirp2 T A 2: 67,511,140 Y1242N probably damaging Het
Ywhag G A 5: 135,911,530 T70M probably damaging Het
Zcchc6 A T 13: 59,814,935 Y339* probably null Het
Zfp248 T C 6: 118,428,970 T452A probably damaging Het
Zfp988 A T 4: 147,332,887 I593F probably damaging Het
Other mutations in Unc80
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Unc80 APN 1 66654395 missense possibly damaging 0.53
IGL00340:Unc80 APN 1 66606459 missense possibly damaging 0.73
IGL00783:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00784:Unc80 APN 1 66608437 missense probably benign 0.37
IGL00935:Unc80 APN 1 66627266 missense possibly damaging 0.53
IGL01094:Unc80 APN 1 66695433 missense possibly damaging 0.90
IGL01466:Unc80 APN 1 66622486 missense probably benign 0.33
IGL01577:Unc80 APN 1 66529968 splice site probably null
IGL01626:Unc80 APN 1 66551054 critical splice donor site probably null
IGL01640:Unc80 APN 1 66679585 missense probably benign 0.33
IGL01775:Unc80 APN 1 66601056 missense possibly damaging 0.94
IGL01960:Unc80 APN 1 66608500 splice site probably benign
IGL01991:Unc80 APN 1 66469509 nonsense probably null
IGL02022:Unc80 APN 1 66626516 missense possibly damaging 0.53
IGL02073:Unc80 APN 1 66612227 missense possibly damaging 0.85
IGL02077:Unc80 APN 1 66525716 missense possibly damaging 0.77
IGL02197:Unc80 APN 1 66530065 missense probably benign 0.39
IGL02198:Unc80 APN 1 66529986 missense possibly damaging 0.88
IGL02228:Unc80 APN 1 66608428 missense possibly damaging 0.72
IGL02327:Unc80 APN 1 66641673 missense probably benign 0.33
IGL02447:Unc80 APN 1 66503544 missense possibly damaging 0.86
IGL02489:Unc80 APN 1 66525701 missense probably benign 0.07
IGL02546:Unc80 APN 1 66554953 missense possibly damaging 0.83
IGL02629:Unc80 APN 1 66483317 missense possibly damaging 0.46
IGL02631:Unc80 APN 1 66530063 missense probably damaging 0.98
IGL02839:Unc80 APN 1 66671675 missense possibly damaging 0.53
IGL02960:Unc80 APN 1 66678058 splice site probably benign
IGL02974:Unc80 APN 1 66525658 missense possibly damaging 0.95
IGL03060:Unc80 APN 1 66637010 missense possibly damaging 0.96
IGL03062:Unc80 APN 1 66509489 missense probably damaging 0.96
IGL03074:Unc80 APN 1 66671718 splice site probably benign
IGL03086:Unc80 APN 1 66509474 missense probably damaging 0.99
IGL03105:Unc80 APN 1 66472099 missense probably damaging 0.96
IGL03107:Unc80 APN 1 66631454 missense probably damaging 0.98
IGL03158:Unc80 APN 1 66641674 missense probably benign 0.33
IGL03220:Unc80 APN 1 66504938 missense probably damaging 0.99
IGL03271:Unc80 APN 1 66695603 unclassified probably benign
IGL03332:Unc80 APN 1 66503631 missense probably damaging 1.00
IGL03347:Unc80 APN 1 66695466 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0012:Unc80 UTSW 1 66507391 missense probably damaging 1.00
R0026:Unc80 UTSW 1 66521584 missense probably benign 0.27
R0055:Unc80 UTSW 1 66506623 splice site probably benign
R0149:Unc80 UTSW 1 66521601 missense possibly damaging 0.82
R0325:Unc80 UTSW 1 66510881 missense probably damaging 1.00
R0329:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0330:Unc80 UTSW 1 66674087 missense possibly damaging 0.96
R0355:Unc80 UTSW 1 66549856 missense possibly damaging 0.77
R0412:Unc80 UTSW 1 66550937 splice site probably benign
R0422:Unc80 UTSW 1 66483338 missense probably damaging 1.00
R0477:Unc80 UTSW 1 66570001 missense probably damaging 0.99
R0507:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0513:Unc80 UTSW 1 66622474 missense possibly damaging 0.73
R0553:Unc80 UTSW 1 66506669 missense probably damaging 0.97
R0626:Unc80 UTSW 1 66608442 missense probably benign 0.01
R0655:Unc80 UTSW 1 66503781 missense probably damaging 0.98
R0742:Unc80 UTSW 1 66527893 missense possibly damaging 0.66
R0755:Unc80 UTSW 1 66504923 missense probably damaging 1.00
R0782:Unc80 UTSW 1 66622581 missense possibly damaging 0.53
R0837:Unc80 UTSW 1 66648944 missense possibly damaging 0.73
R0841:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R0893:Unc80 UTSW 1 66521486 missense probably damaging 0.97
R0900:Unc80 UTSW 1 66671598 missense probably benign 0.33
R0924:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0930:Unc80 UTSW 1 66510641 missense possibly damaging 0.95
R0989:Unc80 UTSW 1 66646440 missense possibly damaging 0.53
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1145:Unc80 UTSW 1 66472088 missense probably damaging 1.00
R1224:Unc80 UTSW 1 66471980 missense probably damaging 1.00
R1240:Unc80 UTSW 1 66635902 missense possibly damaging 0.85
R1245:Unc80 UTSW 1 66555095 missense possibly damaging 0.94
R1467:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1473:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1500:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1556:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R1562:Unc80 UTSW 1 66637957 missense probably damaging 1.00
R1655:Unc80 UTSW 1 66672756 missense possibly damaging 0.86
R1674:Unc80 UTSW 1 66509308 missense probably damaging 1.00
R1680:Unc80 UTSW 1 66503669 nonsense probably null
R1739:Unc80 UTSW 1 66527892 missense probably damaging 0.97
R1756:Unc80 UTSW 1 66639248 missense possibly damaging 0.53
R1783:Unc80 UTSW 1 66683273 missense probably benign 0.01
R1854:Unc80 UTSW 1 66631414 missense possibly damaging 0.93
R1871:Unc80 UTSW 1 66510717 missense possibly damaging 0.77
R1878:Unc80 UTSW 1 66509402 missense probably damaging 0.96
R1883:Unc80 UTSW 1 66525770 missense possibly damaging 0.89
R1912:Unc80 UTSW 1 66510625 missense probably damaging 1.00
R1990:Unc80 UTSW 1 66692549 missense probably damaging 0.97
R2007:Unc80 UTSW 1 66503776 missense probably damaging 1.00
R2035:Unc80 UTSW 1 66606593 missense probably damaging 0.98
R2056:Unc80 UTSW 1 66640552 missense possibly damaging 0.72
R2060:Unc80 UTSW 1 66640595 missense possibly damaging 0.53
R2074:Unc80 UTSW 1 66679744 critical splice donor site probably null
R2088:Unc80 UTSW 1 66590227 missense possibly damaging 0.77
R2089:Unc80 UTSW 1 66671715 splice site probably benign
R2091:Unc80 UTSW 1 66671715 splice site probably benign
R2139:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2169:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2175:Unc80 UTSW 1 66677355 missense probably damaging 1.00
R2248:Unc80 UTSW 1 66623206 splice site probably benign
R2255:Unc80 UTSW 1 66618258 missense possibly damaging 0.53
R2308:Unc80 UTSW 1 66648997 missense possibly damaging 0.53
R2484:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
R2507:Unc80 UTSW 1 66612107 missense possibly damaging 0.53
R2512:Unc80 UTSW 1 66671608 missense possibly damaging 0.70
R2878:Unc80 UTSW 1 66671576 critical splice acceptor site probably benign
R3040:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3104:Unc80 UTSW 1 66623291 missense probably benign 0.33
R3402:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3403:Unc80 UTSW 1 66510686 missense probably damaging 0.97
R3413:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3426:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3427:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3428:Unc80 UTSW 1 66639305 missense probably benign 0.33
R3904:Unc80 UTSW 1 66639296 nonsense probably null
R3916:Unc80 UTSW 1 66677495 missense probably benign 0.11
R3950:Unc80 UTSW 1 66622570 missense possibly damaging 0.53
R4642:Unc80 UTSW 1 66671714 splice site probably null
R4646:Unc80 UTSW 1 66669235 missense probably benign 0.03
R4655:Unc80 UTSW 1 66671662 missense probably benign 0.18
R4662:Unc80 UTSW 1 66646436 missense probably benign 0.01
R4720:Unc80 UTSW 1 66510792 missense possibly damaging 0.92
R4736:Unc80 UTSW 1 66649672 critical splice acceptor site probably null
R4795:Unc80 UTSW 1 66527941 missense probably damaging 0.97
R4888:Unc80 UTSW 1 66644447 missense probably damaging 0.98
R4917:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4918:Unc80 UTSW 1 66646550 missense possibly damaging 0.86
R4983:Unc80 UTSW 1 66674732 intron probably null
R5051:Unc80 UTSW 1 66509477 missense probably damaging 0.96
R5111:Unc80 UTSW 1 66527995 missense possibly damaging 0.66
R5122:Unc80 UTSW 1 66679590 missense possibly damaging 0.53
R5260:Unc80 UTSW 1 66646587 missense possibly damaging 0.53
R5351:Unc80 UTSW 1 66606513 missense possibly damaging 0.73
R5387:Unc80 UTSW 1 66530021 missense possibly damaging 0.77
R5437:Unc80 UTSW 1 66654578 missense possibly damaging 0.96
R5525:Unc80 UTSW 1 66606614 missense possibly damaging 0.72
R5621:Unc80 UTSW 1 66638043 missense possibly damaging 0.53
R5690:Unc80 UTSW 1 66640572 missense probably benign 0.08
R5762:Unc80 UTSW 1 66693796 missense possibly damaging 0.82
R5956:Unc80 UTSW 1 66527964 missense probably damaging 0.97
R6005:Unc80 UTSW 1 66627257 missense possibly damaging 0.53
R6025:Unc80 UTSW 1 66695568 missense possibly damaging 0.90
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6033:Unc80 UTSW 1 66473260 missense possibly damaging 0.92
R6117:Unc80 UTSW 1 66675067 missense possibly damaging 0.72
R6156:Unc80 UTSW 1 66612250 missense probably benign 0.01
R6157:Unc80 UTSW 1 66654029 nonsense probably null
R6189:Unc80 UTSW 1 66677471 missense probably benign 0.33
R6291:Unc80 UTSW 1 66521597 missense possibly damaging 0.82
R6367:Unc80 UTSW 1 66672766 missense probably benign 0.33
R6598:Unc80 UTSW 1 66468540 critical splice donor site probably null
R6724:Unc80 UTSW 1 66683191 missense possibly damaging 0.90
R6763:Unc80 UTSW 1 66521477 missense probably benign 0.00
R6773:Unc80 UTSW 1 66651543 missense probably benign 0.33
R6883:Unc80 UTSW 1 66646404 missense probably benign 0.33
R6951:Unc80 UTSW 1 66648511 missense possibly damaging 0.53
R6965:Unc80 UTSW 1 66646566 missense probably benign 0.33
R6993:Unc80 UTSW 1 66549793 missense possibly damaging 0.60
R7067:Unc80 UTSW 1 66646572 missense possibly damaging 0.86
R7080:Unc80 UTSW 1 66646521 missense possibly damaging 0.53
X0019:Unc80 UTSW 1 66648382 missense probably benign 0.33
X0021:Unc80 UTSW 1 66509266 critical splice acceptor site probably null
X0024:Unc80 UTSW 1 66491046 missense probably benign 0.21
X0062:Unc80 UTSW 1 66623259 missense probably benign 0.02
X0066:Unc80 UTSW 1 66530757 missense possibly damaging 0.77
Y4335:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4336:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Y4338:Unc80 UTSW 1 66521581 missense possibly damaging 0.46
Z1088:Unc80 UTSW 1 66646451 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GGCACTCACATTCTTAAGAGTTTG -3'
(R):5'- TCCAAAACATGTTTACTGTGGG -3'

Sequencing Primer
(F):5'- CTCACATTCTTAAGAGTTTGGCAAC -3'
(R):5'- AAACATGTTTACTGTGGGAGCATTG -3'
Posted On2014-06-23