Incidental Mutation 'R1834:Cttnbp2'
ID205041
Institutional Source Beutler Lab
Gene Symbol Cttnbp2
Ensembl Gene ENSMUSG00000000416
Gene Namecortactin binding protein 2
Synonyms4732477G22Rik, 3010022N24Rik, Cortbp2, ORF4, 9130022E09Rik
MMRRC Submission 039861-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.279) question?
Stock #R1834 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location18366478-18514843 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 18501966 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 16 (V16M)
Ref Sequence ENSEMBL: ENSMUSP00000122590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090601] [ENSMUST00000129669] [ENSMUST00000142963] [ENSMUST00000148602]
Predicted Effect possibly damaging
Transcript: ENSMUST00000090601
AA Change: V58M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000088089
Gene: ENSMUSG00000000416
AA Change: V58M

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
Pfam:CortBP2 32 138 3.1e-34 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
low complexity region 662 673 N/A INTRINSIC
ANK 699 729 5.21e1 SMART
ANK 733 762 7.02e-5 SMART
ANK 766 795 6.55e-5 SMART
ANK 799 828 4.1e-6 SMART
ANK 832 861 1.09e-1 SMART
ANK 901 931 4.43e-2 SMART
Blast:AAA 1108 1285 1e-18 BLAST
low complexity region 1609 1623 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000129669
AA Change: V16M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000116878
Gene: ENSMUSG00000000416
AA Change: V16M

DomainStartEndE-ValueType
Pfam:CortBP2 1 100 4.6e-44 PFAM
Pfam:CortBP2 92 138 3.2e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140416
Predicted Effect probably damaging
Transcript: ENSMUST00000142963
AA Change: V16M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122590
Gene: ENSMUSG00000000416
AA Change: V16M

DomainStartEndE-ValueType
Pfam:CortBP2 1 94 1.8e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000148602
AA Change: V58M

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000118432
Gene: ENSMUSG00000000416
AA Change: V58M

DomainStartEndE-ValueType
Pfam:CortBP2 26 138 4.3e-50 PFAM
Pfam:CortBP2 134 180 1.3e-12 PFAM
low complexity region 197 213 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
low complexity region 393 415 N/A INTRINSIC
low complexity region 539 547 N/A INTRINSIC
low complexity region 594 606 N/A INTRINSIC
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with six ankyrin repeats and several proline-rich regions. A similar gene in rat interacts with a central regulator of the actin cytoskeleton. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,487 D20G probably damaging Het
2310061N02Rik T A 16: 88,707,898 S4C unknown Het
4933416C03Rik T C 10: 116,112,665 R319G probably benign Het
Abca3 A T 17: 24,376,692 N340Y probably benign Het
Abcc1 A G 16: 14,423,117 I513V possibly damaging Het
Acacb C T 5: 114,235,475 T1855M probably damaging Het
Ace A G 11: 105,986,094 probably benign Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adarb1 C A 10: 77,317,231 probably benign Het
Afm T A 5: 90,526,424 M265K probably benign Het
Agl A G 3: 116,788,351 F293S probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgap31 C A 16: 38,603,703 S667I probably benign Het
Bco1 A G 8: 117,117,437 T297A probably benign Het
Bmp1 T C 14: 70,508,831 S123G possibly damaging Het
Caps2 G A 10: 112,195,718 D283N possibly damaging Het
Ccdc57 A C 11: 120,861,219 S845R probably benign Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Chrna6 A G 8: 27,407,214 S212P probably benign Het
Col10a1 G C 10: 34,395,015 A328P probably damaging Het
Col4a2 A G 8: 11,402,997 E188G probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
D430041D05Rik A G 2: 104,168,101 S1102P probably damaging Het
Ddx31 C T 2: 28,892,453 H603Y probably damaging Het
Ddx52 G A 11: 83,959,497 C568Y probably benign Het
Dgki C A 6: 37,034,701 probably benign Het
Dmrt1 A T 19: 25,509,699 Q123L probably damaging Het
Dnah5 A T 15: 28,409,124 M3563L probably benign Het
Dnah7b A T 1: 46,233,759 N2349I possibly damaging Het
Dscaml1 T G 9: 45,683,632 S678A probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Ece1 A G 4: 137,958,128 N643S probably damaging Het
Eno1b A G 18: 48,047,463 Y236C probably damaging Het
Esco1 T C 18: 10,594,350 E312G probably damaging Het
Eya3 T A 4: 132,707,118 V276E probably damaging Het
Fam161b A G 12: 84,348,778 probably benign Het
Fem1c C T 18: 46,505,282 G551D probably damaging Het
Fer1l6 T C 15: 58,557,869 I155T possibly damaging Het
Gbp7 A G 3: 142,534,680 Y53C probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10030 C T 9: 111,004,879 noncoding transcript Het
Gm1966 A T 7: 106,603,776 V87D possibly damaging Het
Gm3443 T A 19: 21,555,679 H2Q unknown Het
Gm5800 T C 14: 51,716,092 E22G possibly damaging Het
Gsdma2 G T 11: 98,649,079 R9L probably damaging Het
Ica1l A G 1: 60,028,236 probably benign Het
Ice1 G A 13: 70,615,338 T167I probably damaging Het
Ifi204 T A 1: 173,747,606 R618S unknown Het
Itga2 C A 13: 114,856,726 K784N probably damaging Het
Itga2 T A 13: 114,856,727 K784M probably damaging Het
Kif3b A G 2: 153,317,485 E402G probably benign Het
Lrp2 T C 2: 69,466,880 I3246V probably benign Het
Lrrn3 G T 12: 41,453,518 L267I probably damaging Het
Map1s A G 8: 70,916,411 Y868C probably damaging Het
Mcm5 A G 8: 75,119,273 T370A possibly damaging Het
Nat8f7 T C 6: 85,707,811 S16G probably benign Het
Nav3 T C 10: 109,720,022 T1683A probably damaging Het
Nbeal2 T C 9: 110,627,129 N2417S probably damaging Het
Neb T C 2: 52,236,895 N3605S probably damaging Het
Net1 A T 13: 3,912,941 probably benign Het
Nsd1 A G 13: 55,313,351 T2464A possibly damaging Het
Nt5e T A 9: 88,370,187 I534N probably damaging Het
Nudt12 T A 17: 59,011,076 H58L probably damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr291 A G 7: 84,856,482 T38A probably damaging Het
Olfr403 A G 11: 74,195,653 H50R probably benign Het
Olfr695 A G 7: 106,874,141 Y35H probably damaging Het
Olfr826 A G 10: 130,180,832 I16T probably benign Het
Pef1 C A 4: 130,121,173 C10* probably null Het
Phf21b A G 15: 84,797,346 Y256H probably damaging Het
Phox2a G T 7: 101,820,945 probably null Het
Pi16 A G 17: 29,327,445 E399G possibly damaging Het
Pipox A T 11: 77,882,123 Y321N probably damaging Het
Plin4 A G 17: 56,103,522 S1170P probably damaging Het
Pnma2 C T 14: 66,917,213 S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 I738T probably damaging Het
Prkcsh A T 9: 22,008,338 K188M probably damaging Het
Rcc1l A T 5: 134,163,659 Y309N probably damaging Het
Ripk1 A G 13: 34,015,213 T123A probably benign Het
Robo4 A G 9: 37,413,059 D961G probably benign Het
Rps27a A G 11: 29,546,299 Y105H probably benign Het
Scaper A G 9: 55,816,734 Y641H possibly damaging Het
Scn1a C A 2: 66,324,616 Q666H probably benign Het
Scn1a T A 2: 66,324,617 Q666L probably benign Het
Sdhaf4 T C 1: 24,003,153 probably null Het
Sec14l3 A G 11: 4,066,510 probably benign Het
Selp C A 1: 164,128,160 probably null Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Sptan1 T A 2: 29,992,001 probably benign Het
Sptbn4 T A 7: 27,366,646 E679V probably null Het
Sytl3 G A 17: 6,728,327 E169K probably benign Het
Taar1 T C 10: 23,921,189 C262R probably benign Het
Tbc1d32 A G 10: 56,017,604 I1291T probably benign Het
Tcrg-C3 A G 13: 19,263,365 T163A possibly damaging Het
Tet1 G A 10: 62,813,665 P89S probably damaging Het
Tgfbrap1 C A 1: 43,071,635 G7W probably damaging Het
Thada A G 17: 84,226,004 V1673A possibly damaging Het
Thbs4 A G 13: 92,761,481 V610A probably benign Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Tmem65 A T 15: 58,787,113 H200Q probably damaging Het
Trim62 T C 4: 128,909,225 V356A possibly damaging Het
Ttn T C 2: 76,732,158 D28781G probably damaging Het
Ttn C T 2: 76,763,260 V20679I probably benign Het
Unc80 A T 1: 66,639,248 T2063S possibly damaging Het
Vav3 A G 3: 109,506,426 T227A probably benign Het
Vmn2r118 A T 17: 55,592,456 I816N probably damaging Het
Vmn2r26 T A 6: 124,061,410 M648K possibly damaging Het
Vmn2r88 T G 14: 51,413,030 probably benign Het
Vwa3a A G 7: 120,790,136 T66A probably benign Het
Xirp2 T A 2: 67,511,140 Y1242N probably damaging Het
Ywhag G A 5: 135,911,530 T70M probably damaging Het
Zcchc6 A T 13: 59,814,935 Y339* probably null Het
Zfp248 T C 6: 118,428,970 T452A probably damaging Het
Zfp988 A T 4: 147,332,887 I593F probably damaging Het
Other mutations in Cttnbp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Cttnbp2 APN 6 18381062 missense possibly damaging 0.71
IGL01014:Cttnbp2 APN 6 18423895 missense probably damaging 0.98
IGL01148:Cttnbp2 APN 6 18382818 missense probably damaging 1.00
IGL01903:Cttnbp2 APN 6 18501965 missense probably damaging 1.00
IGL01906:Cttnbp2 APN 6 18378376 nonsense probably null
IGL01994:Cttnbp2 APN 6 18420815 missense possibly damaging 0.77
IGL02212:Cttnbp2 APN 6 18382749 missense possibly damaging 0.78
IGL02696:Cttnbp2 APN 6 18434129 missense probably benign 0.01
IGL02813:Cttnbp2 APN 6 18367538 missense possibly damaging 0.94
IGL02864:Cttnbp2 APN 6 18374549 missense probably benign 0.21
IGL03309:Cttnbp2 APN 6 18381036 missense probably damaging 0.98
FR4304:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4449:Cttnbp2 UTSW 6 18367462 utr 3 prime probably benign
FR4548:Cttnbp2 UTSW 6 18367463 utr 3 prime probably benign
FR4589:Cttnbp2 UTSW 6 18367458 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367461 utr 3 prime probably benign
FR4976:Cttnbp2 UTSW 6 18367467 utr 3 prime probably benign
R0165:Cttnbp2 UTSW 6 18435410 nonsense probably null
R0382:Cttnbp2 UTSW 6 18435343 missense probably benign 0.39
R0464:Cttnbp2 UTSW 6 18408691 missense possibly damaging 0.81
R0550:Cttnbp2 UTSW 6 18435309 missense possibly damaging 0.89
R0571:Cttnbp2 UTSW 6 18381103 missense probably benign
R0627:Cttnbp2 UTSW 6 18367373 makesense probably null
R0788:Cttnbp2 UTSW 6 18423835 missense probably damaging 1.00
R0826:Cttnbp2 UTSW 6 18405178 splice site probably benign
R1319:Cttnbp2 UTSW 6 18434630 missense probably benign 0.00
R1476:Cttnbp2 UTSW 6 18434221 missense probably damaging 1.00
R1572:Cttnbp2 UTSW 6 18375975 missense possibly damaging 0.68
R1596:Cttnbp2 UTSW 6 18408592 missense probably damaging 1.00
R1607:Cttnbp2 UTSW 6 18435433 missense probably damaging 1.00
R1633:Cttnbp2 UTSW 6 18435167 missense probably damaging 1.00
R1634:Cttnbp2 UTSW 6 18408657 missense probably benign 0.39
R1661:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1665:Cttnbp2 UTSW 6 18434983 missense probably benign 0.20
R1853:Cttnbp2 UTSW 6 18408602 missense probably benign 0.00
R1855:Cttnbp2 UTSW 6 18378413 missense probably benign
R2018:Cttnbp2 UTSW 6 18434518 missense probably damaging 1.00
R2169:Cttnbp2 UTSW 6 18426097 missense probably benign 0.00
R2175:Cttnbp2 UTSW 6 18434829 unclassified probably null
R2202:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2203:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2204:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2205:Cttnbp2 UTSW 6 18408694 missense probably benign 0.12
R2371:Cttnbp2 UTSW 6 18380604 missense possibly damaging 0.69
R2416:Cttnbp2 UTSW 6 18448286 missense probably damaging 0.99
R3414:Cttnbp2 UTSW 6 18389205 missense probably benign
R3617:Cttnbp2 UTSW 6 18414190 missense probably damaging 1.00
R3861:Cttnbp2 UTSW 6 18423833 missense probably benign 0.11
R3862:Cttnbp2 UTSW 6 18434906 missense probably benign 0.02
R3940:Cttnbp2 UTSW 6 18420975 missense probably benign 0.34
R3941:Cttnbp2 UTSW 6 18427453 missense probably benign 0.11
R4097:Cttnbp2 UTSW 6 18420872 missense probably benign
R4211:Cttnbp2 UTSW 6 18427543 missense probably damaging 1.00
R4353:Cttnbp2 UTSW 6 18514704 missense probably benign 0.00
R4367:Cttnbp2 UTSW 6 18405249 missense probably damaging 1.00
R4651:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4652:Cttnbp2 UTSW 6 18434038 missense possibly damaging 0.81
R4660:Cttnbp2 UTSW 6 18406537 missense probably benign 0.05
R4975:Cttnbp2 UTSW 6 18406526 missense possibly damaging 0.91
R5064:Cttnbp2 UTSW 6 18448279 missense probably damaging 1.00
R5205:Cttnbp2 UTSW 6 18427433 splice site probably benign
R5305:Cttnbp2 UTSW 6 18381098 missense probably benign
R5484:Cttnbp2 UTSW 6 18427690 intron probably benign
R5629:Cttnbp2 UTSW 6 18405218 missense probably damaging 1.00
R5763:Cttnbp2 UTSW 6 18414299 missense probably benign 0.00
R5766:Cttnbp2 UTSW 6 18381033 missense possibly damaging 0.87
R5942:Cttnbp2 UTSW 6 18448440 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18434233 missense probably damaging 1.00
R6073:Cttnbp2 UTSW 6 18448369 missense probably benign 0.01
R6163:Cttnbp2 UTSW 6 18434951 missense possibly damaging 0.91
R6545:Cttnbp2 UTSW 6 18405279 intron probably null
R6858:Cttnbp2 UTSW 6 18448453 missense probably damaging 1.00
R7037:Cttnbp2 UTSW 6 18435118 missense probably damaging 1.00
R7135:Cttnbp2 UTSW 6 18448447 missense not run
R7141:Cttnbp2 UTSW 6 18380468 missense not run
Predicted Primers PCR Primer
(F):5'- CCATGGCGATGTCTCAAATCTC -3'
(R):5'- AAGCCATCGTGCTTGGTTTC -3'

Sequencing Primer
(F):5'- TTCTGTCATCTCAAGAACCAACTG -3'
(R):5'- CCATCGTGCTTGGTTTCAGGATATC -3'
Posted On2014-06-23