Incidental Mutation 'R1834:Nav3'
ID205072
Institutional Source Beutler Lab
Gene Symbol Nav3
Ensembl Gene ENSMUSG00000020181
Gene Nameneuron navigator 3
SynonymsPOMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p
MMRRC Submission 039861-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.388) question?
Stock #R1834 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location109681259-110456204 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109720022 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1683 (T1683A)
Ref Sequence ENSEMBL: ENSMUSP00000032719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032719]
Predicted Effect probably damaging
Transcript: ENSMUST00000032719
AA Change: T1683A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: T1683A

DomainStartEndE-ValueType
CH 79 182 4.41e-12 SMART
low complexity region 184 194 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 353 363 N/A INTRINSIC
low complexity region 427 439 N/A INTRINSIC
low complexity region 522 536 N/A INTRINSIC
low complexity region 713 724 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 904 916 N/A INTRINSIC
low complexity region 1077 1095 N/A INTRINSIC
low complexity region 1160 1173 N/A INTRINSIC
low complexity region 1207 1229 N/A INTRINSIC
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1274 1285 N/A INTRINSIC
low complexity region 1293 1312 N/A INTRINSIC
low complexity region 1327 1341 N/A INTRINSIC
low complexity region 1383 1397 N/A INTRINSIC
low complexity region 1462 1474 N/A INTRINSIC
low complexity region 1550 1563 N/A INTRINSIC
coiled coil region 1565 1656 N/A INTRINSIC
low complexity region 1675 1692 N/A INTRINSIC
low complexity region 1722 1733 N/A INTRINSIC
low complexity region 1756 1781 N/A INTRINSIC
low complexity region 1782 1795 N/A INTRINSIC
coiled coil region 1801 1842 N/A INTRINSIC
low complexity region 1848 1871 N/A INTRINSIC
AAA 2029 2184 4.94e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161223
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161582
SMART Domains Protein: ENSMUSP00000124591
Gene: ENSMUSG00000020181

DomainStartEndE-ValueType
low complexity region 84 95 N/A INTRINSIC
low complexity region 150 173 N/A INTRINSIC
low complexity region 181 193 N/A INTRINSIC
low complexity region 354 372 N/A INTRINSIC
low complexity region 437 450 N/A INTRINSIC
low complexity region 484 506 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 551 562 N/A INTRINSIC
low complexity region 570 589 N/A INTRINSIC
low complexity region 604 618 N/A INTRINSIC
low complexity region 660 674 N/A INTRINSIC
low complexity region 739 751 N/A INTRINSIC
low complexity region 827 840 N/A INTRINSIC
coiled coil region 842 933 N/A INTRINSIC
low complexity region 952 969 N/A INTRINSIC
low complexity region 992 1003 N/A INTRINSIC
low complexity region 1026 1051 N/A INTRINSIC
low complexity region 1052 1065 N/A INTRINSIC
coiled coil region 1071 1112 N/A INTRINSIC
low complexity region 1118 1141 N/A INTRINSIC
AAA 1299 1454 4.94e-7 SMART
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 92.0%
Validation Efficiency 97% (116/119)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 114 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310033P09Rik A G 11: 59,208,487 D20G probably damaging Het
2310061N02Rik T A 16: 88,707,898 S4C unknown Het
4933416C03Rik T C 10: 116,112,665 R319G probably benign Het
Abca3 A T 17: 24,376,692 N340Y probably benign Het
Abcc1 A G 16: 14,423,117 I513V possibly damaging Het
Acacb C T 5: 114,235,475 T1855M probably damaging Het
Ace A G 11: 105,986,094 probably benign Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adarb1 C A 10: 77,317,231 probably benign Het
Afm T A 5: 90,526,424 M265K probably benign Het
Agl A G 3: 116,788,351 F293S probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgap31 C A 16: 38,603,703 S667I probably benign Het
Bco1 A G 8: 117,117,437 T297A probably benign Het
Bmp1 T C 14: 70,508,831 S123G possibly damaging Het
Caps2 G A 10: 112,195,718 D283N possibly damaging Het
Ccdc57 A C 11: 120,861,219 S845R probably benign Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Chrna6 A G 8: 27,407,214 S212P probably benign Het
Col10a1 G C 10: 34,395,015 A328P probably damaging Het
Col4a2 A G 8: 11,402,997 E188G probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cttnbp2 C T 6: 18,501,966 V16M probably damaging Het
D430041D05Rik A G 2: 104,168,101 S1102P probably damaging Het
Ddx31 C T 2: 28,892,453 H603Y probably damaging Het
Ddx52 G A 11: 83,959,497 C568Y probably benign Het
Dgki C A 6: 37,034,701 probably benign Het
Dmrt1 A T 19: 25,509,699 Q123L probably damaging Het
Dnah5 A T 15: 28,409,124 M3563L probably benign Het
Dnah7b A T 1: 46,233,759 N2349I possibly damaging Het
Dscaml1 T G 9: 45,683,632 S678A probably benign Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Ece1 A G 4: 137,958,128 N643S probably damaging Het
Eno1b A G 18: 48,047,463 Y236C probably damaging Het
Esco1 T C 18: 10,594,350 E312G probably damaging Het
Eya3 T A 4: 132,707,118 V276E probably damaging Het
Fam161b A G 12: 84,348,778 probably benign Het
Fem1c C T 18: 46,505,282 G551D probably damaging Het
Fer1l6 T C 15: 58,557,869 I155T possibly damaging Het
Gbp7 A G 3: 142,534,680 Y53C probably damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm10030 C T 9: 111,004,879 noncoding transcript Het
Gm1966 A T 7: 106,603,776 V87D possibly damaging Het
Gm3443 T A 19: 21,555,679 H2Q unknown Het
Gm5800 T C 14: 51,716,092 E22G possibly damaging Het
Gsdma2 G T 11: 98,649,079 R9L probably damaging Het
Ica1l A G 1: 60,028,236 probably benign Het
Ice1 G A 13: 70,615,338 T167I probably damaging Het
Ifi204 T A 1: 173,747,606 R618S unknown Het
Itga2 C A 13: 114,856,726 K784N probably damaging Het
Itga2 T A 13: 114,856,727 K784M probably damaging Het
Kif3b A G 2: 153,317,485 E402G probably benign Het
Lrp2 T C 2: 69,466,880 I3246V probably benign Het
Lrrn3 G T 12: 41,453,518 L267I probably damaging Het
Map1s A G 8: 70,916,411 Y868C probably damaging Het
Mcm5 A G 8: 75,119,273 T370A possibly damaging Het
Nat8f7 T C 6: 85,707,811 S16G probably benign Het
Nbeal2 T C 9: 110,627,129 N2417S probably damaging Het
Neb T C 2: 52,236,895 N3605S probably damaging Het
Net1 A T 13: 3,912,941 probably benign Het
Nsd1 A G 13: 55,313,351 T2464A possibly damaging Het
Nt5e T A 9: 88,370,187 I534N probably damaging Het
Nudt12 T A 17: 59,011,076 H58L probably damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr291 A G 7: 84,856,482 T38A probably damaging Het
Olfr403 A G 11: 74,195,653 H50R probably benign Het
Olfr695 A G 7: 106,874,141 Y35H probably damaging Het
Olfr826 A G 10: 130,180,832 I16T probably benign Het
Pef1 C A 4: 130,121,173 C10* probably null Het
Phf21b A G 15: 84,797,346 Y256H probably damaging Het
Phox2a G T 7: 101,820,945 probably null Het
Pi16 A G 17: 29,327,445 E399G possibly damaging Het
Pipox A T 11: 77,882,123 Y321N probably damaging Het
Plin4 A G 17: 56,103,522 S1170P probably damaging Het
Pnma2 C T 14: 66,917,213 S362L possibly damaging Het
Ppp1r9a T C 6: 5,113,710 I738T probably damaging Het
Prkcsh A T 9: 22,008,338 K188M probably damaging Het
Rcc1l A T 5: 134,163,659 Y309N probably damaging Het
Ripk1 A G 13: 34,015,213 T123A probably benign Het
Robo4 A G 9: 37,413,059 D961G probably benign Het
Rps27a A G 11: 29,546,299 Y105H probably benign Het
Scaper A G 9: 55,816,734 Y641H possibly damaging Het
Scn1a C A 2: 66,324,616 Q666H probably benign Het
Scn1a T A 2: 66,324,617 Q666L probably benign Het
Sdhaf4 T C 1: 24,003,153 probably null Het
Sec14l3 A G 11: 4,066,510 probably benign Het
Selp C A 1: 164,128,160 probably null Het
Sim1 A G 10: 50,909,828 D259G probably damaging Het
Sptan1 T A 2: 29,992,001 probably benign Het
Sptbn4 T A 7: 27,366,646 E679V probably null Het
Sytl3 G A 17: 6,728,327 E169K probably benign Het
Taar1 T C 10: 23,921,189 C262R probably benign Het
Tbc1d32 A G 10: 56,017,604 I1291T probably benign Het
Tcrg-C3 A G 13: 19,263,365 T163A possibly damaging Het
Tet1 G A 10: 62,813,665 P89S probably damaging Het
Tgfbrap1 C A 1: 43,071,635 G7W probably damaging Het
Thada A G 17: 84,226,004 V1673A possibly damaging Het
Thbs4 A G 13: 92,761,481 V610A probably benign Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Tmem65 A T 15: 58,787,113 H200Q probably damaging Het
Trim62 T C 4: 128,909,225 V356A possibly damaging Het
Ttn T C 2: 76,732,158 D28781G probably damaging Het
Ttn C T 2: 76,763,260 V20679I probably benign Het
Unc80 A T 1: 66,639,248 T2063S possibly damaging Het
Vav3 A G 3: 109,506,426 T227A probably benign Het
Vmn2r118 A T 17: 55,592,456 I816N probably damaging Het
Vmn2r26 T A 6: 124,061,410 M648K possibly damaging Het
Vmn2r88 T G 14: 51,413,030 probably benign Het
Vwa3a A G 7: 120,790,136 T66A probably benign Het
Xirp2 T A 2: 67,511,140 Y1242N probably damaging Het
Ywhag G A 5: 135,911,530 T70M probably damaging Het
Zcchc6 A T 13: 59,814,935 Y339* probably null Het
Zfp248 T C 6: 118,428,970 T452A probably damaging Het
Zfp988 A T 4: 147,332,887 I593F probably damaging Het
Other mutations in Nav3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Nav3 APN 10 109841733 missense probably damaging 0.99
IGL00425:Nav3 APN 10 109703507 missense probably benign 0.13
IGL00465:Nav3 APN 10 109852746 missense probably damaging 0.99
IGL00531:Nav3 APN 10 109703310 missense probably null 0.99
IGL00575:Nav3 APN 10 109764765 missense probably damaging 0.98
IGL00770:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00774:Nav3 APN 10 109816263 missense probably damaging 1.00
IGL00858:Nav3 APN 10 109742632 missense probably damaging 0.98
IGL00935:Nav3 APN 10 109705666 missense probably benign
IGL01638:Nav3 APN 10 109852863 missense probably damaging 1.00
IGL01662:Nav3 APN 10 109769258 missense possibly damaging 0.56
IGL01670:Nav3 APN 10 109714241 missense possibly damaging 0.92
IGL01885:Nav3 APN 10 109742660 nonsense probably null
IGL01979:Nav3 APN 10 109704929 missense probably benign 0.01
IGL02121:Nav3 APN 10 109759036 missense probably damaging 0.99
IGL02210:Nav3 APN 10 109766990 missense probably benign
IGL02523:Nav3 APN 10 109769296 missense probably damaging 1.00
IGL02573:Nav3 APN 10 109866974 missense probably benign 0.23
IGL02633:Nav3 APN 10 109692136 missense probably benign 0.09
IGL02810:Nav3 APN 10 109816274 missense probably damaging 1.00
IGL02964:Nav3 APN 10 109736953 missense probably damaging 0.99
IGL03015:Nav3 APN 10 109718297 missense probably damaging 0.98
IGL03288:Nav3 APN 10 109759017 missense probably damaging 1.00
IGL03310:Nav3 APN 10 109824572 critical splice donor site probably null
PIT4377001:Nav3 UTSW 10 109716605 missense probably damaging 0.99
R0010:Nav3 UTSW 10 109823226 splice site probably benign
R0043:Nav3 UTSW 10 109767518 missense possibly damaging 0.95
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0053:Nav3 UTSW 10 109766917 splice site probably benign
R0077:Nav3 UTSW 10 109716642 missense possibly damaging 0.87
R0219:Nav3 UTSW 10 109866930 critical splice donor site probably null
R0310:Nav3 UTSW 10 109767128 missense possibly damaging 0.82
R0380:Nav3 UTSW 10 109758879 splice site probably benign
R0403:Nav3 UTSW 10 109767103 missense probably damaging 0.98
R0480:Nav3 UTSW 10 109853300 missense probably damaging 1.00
R0626:Nav3 UTSW 10 109823464 missense probably damaging 1.00
R0637:Nav3 UTSW 10 109770197 missense probably benign 0.25
R0847:Nav3 UTSW 10 109903857 missense possibly damaging 0.94
R0988:Nav3 UTSW 10 109716528 missense probably damaging 1.00
R1272:Nav3 UTSW 10 109736999 missense probably damaging 0.98
R1295:Nav3 UTSW 10 109692102 missense probably damaging 1.00
R1405:Nav3 UTSW 10 109770333 splice site probably benign
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1406:Nav3 UTSW 10 109883634 missense possibly damaging 0.64
R1420:Nav3 UTSW 10 109823254 missense probably benign 0.02
R1449:Nav3 UTSW 10 109853511 missense probably benign 0.13
R1458:Nav3 UTSW 10 109720044 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1469:Nav3 UTSW 10 109760508 missense probably damaging 1.00
R1472:Nav3 UTSW 10 109727941 missense probably damaging 0.99
R1537:Nav3 UTSW 10 109866985 missense probably damaging 1.00
R1539:Nav3 UTSW 10 109767170 missense probably damaging 0.99
R1581:Nav3 UTSW 10 109823428 missense probably damaging 1.00
R1586:Nav3 UTSW 10 109853254 missense probably damaging 1.00
R1654:Nav3 UTSW 10 109853123 missense possibly damaging 0.85
R1725:Nav3 UTSW 10 109823590 missense probably damaging 1.00
R1742:Nav3 UTSW 10 109769213 missense probably benign
R1793:Nav3 UTSW 10 109703372 missense probably benign 0.00
R1830:Nav3 UTSW 10 109823323 missense probably damaging 1.00
R1881:Nav3 UTSW 10 109852559 missense probably damaging 0.96
R1922:Nav3 UTSW 10 109705606 missense probably benign 0.43
R1944:Nav3 UTSW 10 109716530 missense probably damaging 0.99
R1981:Nav3 UTSW 10 109719090 splice site probably benign
R1985:Nav3 UTSW 10 109770184 splice site probably benign
R1996:Nav3 UTSW 10 109853401 missense probably damaging 1.00
R2051:Nav3 UTSW 10 109824675 missense probably damaging 0.99
R2062:Nav3 UTSW 10 109720021 missense probably damaging 1.00
R2139:Nav3 UTSW 10 109853135 missense probably benign 0.22
R2248:Nav3 UTSW 10 109696227 missense probably damaging 1.00
R2420:Nav3 UTSW 10 109863813 missense probably damaging 0.98
R2444:Nav3 UTSW 10 109764915 missense probably benign 0.09
R3026:Nav3 UTSW 10 109824604 missense probably damaging 0.99
R3052:Nav3 UTSW 10 109903752 missense probably damaging 0.99
R3441:Nav3 UTSW 10 109704928 missense probably benign 0.01
R3845:Nav3 UTSW 10 109853376 missense possibly damaging 0.82
R3929:Nav3 UTSW 10 109684203 missense probably damaging 1.00
R3932:Nav3 UTSW 10 109694035 missense probably damaging 0.99
R4056:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4057:Nav3 UTSW 10 109880533 critical splice donor site probably null
R4120:Nav3 UTSW 10 109903744 critical splice donor site probably null
R4244:Nav3 UTSW 10 109769296 missense probably damaging 1.00
R4361:Nav3 UTSW 10 109852986 missense probably damaging 1.00
R4512:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4514:Nav3 UTSW 10 109694082 missense possibly damaging 0.89
R4700:Nav3 UTSW 10 109764935 missense probably benign 0.10
R4815:Nav3 UTSW 10 109823552 missense probably benign
R4981:Nav3 UTSW 10 109880692 missense probably benign
R5042:Nav3 UTSW 10 109769268 missense probably benign 0.27
R5251:Nav3 UTSW 10 109853253 missense probably damaging 0.99
R5252:Nav3 UTSW 10 109714291 small deletion probably benign
R5273:Nav3 UTSW 10 109693038 critical splice donor site probably null
R5288:Nav3 UTSW 10 109853105 missense probably benign 0.10
R5407:Nav3 UTSW 10 109866935 missense probably benign 0.28
R5533:Nav3 UTSW 10 109883678 missense possibly damaging 0.61
R5561:Nav3 UTSW 10 109716552 missense probably damaging 1.00
R5577:Nav3 UTSW 10 109769403 missense probably damaging 1.00
R5656:Nav3 UTSW 10 109764633 missense probably damaging 0.96
R5872:Nav3 UTSW 10 109764787 missense probably damaging 1.00
R6023:Nav3 UTSW 10 109823515 missense possibly damaging 0.95
R6061:Nav3 UTSW 10 109866984 nonsense probably null
R6189:Nav3 UTSW 10 109720019 missense probably damaging 0.98
R6214:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6215:Nav3 UTSW 10 109852565 missense probably damaging 1.00
R6264:Nav3 UTSW 10 109688833 missense probably damaging 0.97
R6500:Nav3 UTSW 10 109764756 missense probably damaging 1.00
R6524:Nav3 UTSW 10 109720030 missense probably damaging 0.99
R6868:Nav3 UTSW 10 109693166 missense possibly damaging 0.49
R7079:Nav3 UTSW 10 109767292 missense probably benign 0.16
R7099:Nav3 UTSW 10 109703334 missense probably benign 0.11
R7139:Nav3 UTSW 10 109853477 missense probably benign 0.44
X0012:Nav3 UTSW 10 109692097 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATACGAGGTCTTCACC -3'
(R):5'- CATCAGAACAAACTACAGTGGAGTG -3'

Sequencing Primer
(F):5'- AGATGCTGGTCCCTGAAGG -3'
(R):5'- TGATAGCTGTAGAAAGCCTTGC -3'
Posted On2014-06-23