Incidental Mutation 'R1835:Cacna1a'
ID205174
Institutional Source Beutler Lab
Gene Symbol Cacna1a
Ensembl Gene ENSMUSG00000034656
Gene Namecalcium channel, voltage-dependent, P/Q type, alpha 1A subunit
SynonymsCacnl1a4, alpha1A, SCA6, nmf352, Ccha1a
MMRRC Submission 039862-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.905) question?
Stock #R1835 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location84388440-84640246 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 84581357 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000121390] [ENSMUST00000122053]
Predicted Effect probably null
Transcript: ENSMUST00000121390
SMART Domains Protein: ENSMUSP00000112436
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 99 373 1.5e-69 PFAM
Pfam:Ion_trans 488 727 1.2e-54 PFAM
Pfam:PKD_channel 578 721 6.6e-8 PFAM
low complexity region 920 959 N/A INTRINSIC
low complexity region 977 987 N/A INTRINSIC
low complexity region 1074 1093 N/A INTRINSIC
low complexity region 1143 1168 N/A INTRINSIC
Pfam:Ion_trans 1194 1472 4.9e-64 PFAM
Pfam:Ion_trans 1516 1773 2.8e-64 PFAM
Pfam:GPHH 1775 1844 5.6e-39 PFAM
Ca_chan_IQ 1899 1933 1.8e-12 SMART
AT_hook 2053 2065 2.02e0 SMART
low complexity region 2101 2113 N/A INTRINSIC
low complexity region 2153 2179 N/A INTRINSIC
low complexity region 2213 2236 N/A INTRINSIC
low complexity region 2253 2282 N/A INTRINSIC
low complexity region 2314 2325 N/A INTRINSIC
low complexity region 2342 2357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000122053
SMART Domains Protein: ENSMUSP00000114055
Gene: ENSMUSG00000034656

DomainStartEndE-ValueType
low complexity region 9 47 N/A INTRINSIC
Pfam:Ion_trans 91 314 4.5e-58 PFAM
PDB:4DEX|B 317 427 5e-45 PDB
Pfam:Ion_trans 476 668 6.4e-46 PFAM
Pfam:PKD_channel 530 675 7.7e-8 PFAM
low complexity region 873 912 N/A INTRINSIC
low complexity region 930 940 N/A INTRINSIC
low complexity region 1027 1046 N/A INTRINSIC
low complexity region 1096 1121 N/A INTRINSIC
Pfam:Ion_trans 1183 1414 2.8e-54 PFAM
Pfam:Ion_trans 1504 1714 3.2e-60 PFAM
Ca_chan_IQ 1852 1886 1.8e-12 SMART
AT_hook 2006 2018 2.02e0 SMART
low complexity region 2054 2066 N/A INTRINSIC
low complexity region 2106 2132 N/A INTRINSIC
low complexity region 2166 2189 N/A INTRINSIC
low complexity region 2206 2235 N/A INTRINSIC
low complexity region 2267 2278 N/A INTRINSIC
low complexity region 2295 2310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126302
Predicted Effect probably null
Transcript: ENSMUST00000215756
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent calcium channels mediate the entry of calcium ions into excitable cells, and are also involved in a variety of calcium-dependent processes, including muscle contraction, hormone or neurotransmitter release, and gene expression. Calcium channels are multisubunit complexes composed of alpha-1, beta, alpha-2/delta, and gamma subunits. The channel activity is directed by the pore-forming alpha-1 subunit, whereas, the others act as auxiliary subunits regulating this activity. The distinctive properties of the calcium channel types are related primarily to the expression of a variety of alpha-1 isoforms, alpha-1A, B, C, D, E, and S. This gene encodes the alpha-1A subunit, which is predominantly expressed in neuronal tissue. Mutations in this gene are associated with 2 neurologic disorders, familial hemiplegic migraine and episodic ataxia 2. This gene also exhibits polymorphic variation due to (CAG)n-repeats. Multiple transcript variants encoding different isoforms have been found for this gene. In one set of transcript variants, the (CAG)n-repeats occur in the 3' UTR, and are not associated with any disease. But in another set of variants, an insertion extends the coding region to include the (CAG)n-repeats which encode a polyglutamine tract. Expansion of the (CAG)n-repeats from the normal 4-18 to 21-33 in the coding region is associated with spinocerebellar ataxia 6. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for different mutant alleles are characterized by variably severe wobbly gait beginning prior to weaning, ataxia, episodic dyskinesia, cerebellar atrophy, and absence epilepsy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G T 11: 78,287,750 V1993F probably damaging Het
4933425L06Rik C A 13: 105,082,194 A12E unknown Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam4 T C 12: 81,419,559 I763V probably benign Het
Aipl1 T G 11: 72,030,499 K190T possibly damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Alpi A G 1: 87,099,414 V381A possibly damaging Het
Ankfn1 A T 11: 89,447,618 S365R probably benign Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Apc T A 18: 34,317,077 L2308Q probably damaging Het
Atp9b C T 18: 80,778,883 V501I probably benign Het
Baz2b T C 2: 59,901,819 E1994G probably benign Het
Cacna1h C A 17: 25,392,076 V583L probably benign Het
Cd55 T C 1: 130,447,609 probably benign Het
Cep192 T A 18: 67,804,424 S75T possibly damaging Het
Cfap54 T A 10: 92,962,375 D1674V probably benign Het
Churc1 T C 12: 76,773,297 F27L possibly damaging Het
Coro1c A G 5: 113,848,543 I280T probably benign Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Cyp2b9 A G 7: 26,200,783 T339A probably benign Het
Dctn3 T C 4: 41,720,813 R51G probably damaging Het
Ddb1 T C 19: 10,626,593 V888A probably damaging Het
Disp1 A G 1: 183,089,000 Y619H probably damaging Het
Dnajc9 T C 14: 20,388,334 D96G possibly damaging Het
Eepd1 A G 9: 25,482,868 T143A possibly damaging Het
Eps8 T A 6: 137,522,279 K204* probably null Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Ergic2 T A 6: 148,189,581 Y211F possibly damaging Het
Fam135b G T 15: 71,490,711 L274M probably damaging Het
Fat3 G A 9: 15,998,088 T2206I probably damaging Het
Fat4 A G 3: 38,983,571 I3791V probably benign Het
Gemin4 A G 11: 76,213,296 M213T possibly damaging Het
Gnai3 T C 3: 108,118,407 M119V probably benign Het
Heatr5b A T 17: 78,773,563 L1420Q probably damaging Het
Herc2 G T 7: 56,206,765 G3918* probably null Het
Ints9 A G 14: 65,032,256 Y465C probably damaging Het
Ist1 A G 8: 109,678,883 V175A probably damaging Het
Kcnj12 T C 11: 61,069,557 L227P possibly damaging Het
Kcnq5 T C 1: 21,466,387 S416G probably benign Het
Kdm3a T A 6: 71,613,956 T295S probably benign Het
Kif1c T A 11: 70,708,971 M479K probably damaging Het
Kif20b T C 19: 34,956,038 L83P probably damaging Het
Kndc1 A G 7: 139,927,711 E1194G probably damaging Het
Llgl1 A G 11: 60,704,730 M81V probably benign Het
Map4k5 C A 12: 69,824,662 M495I probably damaging Het
Mest C T 6: 30,742,791 R146C probably benign Het
Mettl24 T A 10: 40,737,816 probably null Het
Mical1 T C 10: 41,483,535 S586P probably benign Het
Mrgpra3 G T 7: 47,589,946 Y77* probably null Het
Mss51 A T 14: 20,483,178 C408* probably null Het
Myh6 T C 14: 54,957,401 T666A probably benign Het
Myo10 T C 15: 25,805,587 C1685R possibly damaging Het
Naip5 A T 13: 100,223,218 Y503* probably null Het
Neil1 A C 9: 57,146,604 F144C probably damaging Het
Nipbl T A 15: 8,343,517 I1082F possibly damaging Het
Nkiras1 T C 14: 18,276,732 V7A probably damaging Het
Ntng2 G A 2: 29,197,057 Q384* probably null Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr137 A T 17: 38,305,312 S50T probably benign Het
Olfr1385 A T 11: 49,494,670 I46F probably damaging Het
Olfr1408 A G 1: 173,130,815 V134A probably benign Het
Olfr381 A C 11: 73,486,374 V150G probably benign Het
Olfr535 A G 7: 140,492,709 S24G probably benign Het
Olfr761 C T 17: 37,952,385 G213E possibly damaging Het
Patj A G 4: 98,491,590 D151G probably benign Het
Plpbp T C 8: 27,049,231 V126A probably damaging Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Ppp1r12c A C 7: 4,483,651 S480A probably damaging Het
Pum1 T C 4: 130,701,048 S124P possibly damaging Het
Pwp2 C G 10: 78,179,091 G353A probably damaging Het
Reln C A 5: 21,979,002 Q1666H probably damaging Het
Rnf19a T C 15: 36,265,925 I9V probably benign Het
Ryr2 T C 13: 11,769,878 H1063R probably benign Het
Samd14 C G 11: 95,023,600 D361E probably damaging Het
Samd15 A T 12: 87,201,843 N365I probably damaging Het
Sec16b A G 1: 157,531,312 H105R probably benign Het
Sez6 T C 11: 77,953,503 S51P probably benign Het
Sh3bp1 T A 15: 78,905,150 L236Q probably damaging Het
Sspo C T 6: 48,457,340 T991I probably damaging Het
Suco A T 1: 161,859,500 L97* probably null Het
Tab1 C A 15: 80,148,296 R35S probably benign Het
Tet3 C A 6: 83,404,163 S341I possibly damaging Het
Tlr1 A T 5: 64,925,700 D511E probably benign Het
Tmem132b A C 5: 125,785,899 D656A probably damaging Het
Tmtc4 T A 14: 122,941,988 probably null Het
Trmo T C 4: 46,380,158 T404A probably damaging Het
Trpm1 A G 7: 64,230,268 K790E probably damaging Het
Ulk4 C A 9: 121,168,184 R774M probably null Het
Ush2a C T 1: 188,451,818 L1440F probably benign Het
Usp16 A G 16: 87,480,907 K682E probably damaging Het
Virma T C 4: 11,540,511 S1471P probably benign Het
Vmn1r177 A T 7: 23,865,686 I255N probably damaging Het
Vmn2r61 A T 7: 42,266,652 R230* probably null Het
Vps13c T A 9: 67,993,013 F3671L probably benign Het
Washc5 T C 15: 59,359,340 N358S possibly damaging Het
Wdr72 A G 9: 74,151,617 K331E probably damaging Het
Zfp986 A T 4: 145,899,235 K155I probably benign Het
Other mutations in Cacna1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Cacna1a APN 8 84571208 nonsense probably null
IGL00513:Cacna1a APN 8 84553056 missense probably damaging 1.00
IGL00569:Cacna1a APN 8 84462714 missense probably damaging 1.00
IGL00981:Cacna1a APN 8 84548553 missense probably damaging 1.00
IGL01122:Cacna1a APN 8 84614793 critical splice donor site probably null
IGL01309:Cacna1a APN 8 84523028 missense probably damaging 1.00
IGL01380:Cacna1a APN 8 84559117 missense probably damaging 1.00
IGL01638:Cacna1a APN 8 84571827 missense probably damaging 0.98
IGL01682:Cacna1a APN 8 84536438 missense possibly damaging 0.71
IGL02751:Cacna1a APN 8 84569952 missense probably damaging 1.00
IGL02904:Cacna1a APN 8 84579520 missense probably damaging 1.00
IGL03122:Cacna1a APN 8 84462676 splice site probably benign
totter UTSW 8 84588753 missense probably damaging 0.99
totter2 UTSW 8 84588753 missense probably damaging 0.99
FR4340:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638714 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4449:Cacna1a UTSW 8 84638723 small insertion probably benign
FR4548:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638720 small insertion probably benign
FR4737:Cacna1a UTSW 8 84638726 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638717 small insertion probably benign
FR4976:Cacna1a UTSW 8 84638726 small insertion probably benign
IGL03134:Cacna1a UTSW 8 84559087 missense probably damaging 1.00
R0055:Cacna1a UTSW 8 84580058 splice site probably benign
R0118:Cacna1a UTSW 8 84536083 missense probably damaging 1.00
R0284:Cacna1a UTSW 8 84612285 missense probably damaging 1.00
R0581:Cacna1a UTSW 8 84601936 missense possibly damaging 0.83
R0607:Cacna1a UTSW 8 84629831 missense probably damaging 1.00
R1168:Cacna1a UTSW 8 84579501 missense probably damaging 1.00
R1183:Cacna1a UTSW 8 84580217 missense probably damaging 1.00
R1470:Cacna1a UTSW 8 84514950 splice site probably benign
R1503:Cacna1a UTSW 8 84601946 missense probably benign 0.23
R1522:Cacna1a UTSW 8 84633433 missense probably benign 0.00
R1862:Cacna1a UTSW 8 84415930 missense possibly damaging 0.80
R2148:Cacna1a UTSW 8 84629675 missense possibly damaging 0.71
R2237:Cacna1a UTSW 8 84633765 critical splice donor site probably null
R2567:Cacna1a UTSW 8 84549725 missense probably damaging 1.00
R2999:Cacna1a UTSW 8 84567742 missense probably damaging 1.00
R3025:Cacna1a UTSW 8 84580225 critical splice donor site probably null
R3610:Cacna1a UTSW 8 84559065 missense probably damaging 1.00
R3702:Cacna1a UTSW 8 84617846 missense probably damaging 0.98
R3763:Cacna1a UTSW 8 84583642 missense possibly damaging 0.85
R4025:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4026:Cacna1a UTSW 8 84581333 missense probably damaging 1.00
R4106:Cacna1a UTSW 8 84583695 missense possibly damaging 0.85
R4296:Cacna1a UTSW 8 84559293 missense probably damaging 1.00
R4664:Cacna1a UTSW 8 84601767 nonsense probably null
R4713:Cacna1a UTSW 8 84549514 missense probably damaging 1.00
R5223:Cacna1a UTSW 8 84587195 missense possibly damaging 0.94
R5408:Cacna1a UTSW 8 84549707 missense probably damaging 1.00
R5644:Cacna1a UTSW 8 84462777 missense probably damaging 1.00
R5734:Cacna1a UTSW 8 84583731 missense probably damaging 0.96
R5786:Cacna1a UTSW 8 84415721 unclassified probably benign
R5833:Cacna1a UTSW 8 84518697 missense probably damaging 1.00
R5886:Cacna1a UTSW 8 84523022 missense probably damaging 0.99
R6049:Cacna1a UTSW 8 84638846 missense probably damaging 0.96
R6054:Cacna1a UTSW 8 84556785 missense probably damaging 0.99
R6117:Cacna1a UTSW 8 84614721 missense probably damaging 1.00
R6149:Cacna1a UTSW 8 84569952 missense probably damaging 1.00
R6195:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6233:Cacna1a UTSW 8 84588753 missense probably damaging 0.99
R6607:Cacna1a UTSW 8 84579492 missense probably damaging 1.00
R6753:Cacna1a UTSW 8 84580205 missense probably damaging 1.00
R6798:Cacna1a UTSW 8 84611602 missense probably damaging 1.00
R6831:Cacna1a UTSW 8 84571231 missense probably damaging 1.00
R6980:Cacna1a UTSW 8 84612285 missense possibly damaging 0.85
R7051:Cacna1a UTSW 8 84629915 missense possibly damaging 0.85
R7270:Cacna1a UTSW 8 84571237 missense probably damaging 1.00
X0022:Cacna1a UTSW 8 84633699 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- TACACTCAAGCCAGGGTCTC -3'
(R):5'- AAGTCTGTGTTCACATTTGTGC -3'

Sequencing Primer
(F):5'- AGCACACGTGGCCTTAGG -3'
(R):5'- GGACCTGAGCTTCCCAACAG -3'
Posted On2014-06-23