Incidental Mutation 'R0112:Slc19a1'
ID20523
Institutional Source Beutler Lab
Gene Symbol Slc19a1
Ensembl Gene ENSMUSG00000001436
Gene Namesolute carrier family 19 (folate transporter), member 1
SynonymsRFC1, RFC-1, reduced folate carrier
MMRRC Submission 038398-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0112 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location77032241-77061002 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77042165 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 178 (I178T)
Ref Sequence ENSEMBL: ENSMUSP00000116657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105410] [ENSMUST00000130703] [ENSMUST00000132984] [ENSMUST00000133059] [ENSMUST00000136150] [ENSMUST00000136925] [ENSMUST00000144234]
Predicted Effect probably benign
Transcript: ENSMUST00000105410
AA Change: I178T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101050
Gene: ENSMUSG00000001436
AA Change: I178T

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127249
Predicted Effect probably benign
Transcript: ENSMUST00000130703
SMART Domains Protein: ENSMUSP00000115658
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 64 9.3e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131031
SMART Domains Protein: ENSMUSP00000114884
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 1 112 1.3e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132984
AA Change: I178T

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000116657
Gene: ENSMUSG00000001436
AA Change: I178T

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 233 4.8e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133059
SMART Domains Protein: ENSMUSP00000120266
Gene: ENSMUSG00000001436

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 70 7.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136150
AA Change: I178T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000121237
Gene: ENSMUSG00000001436
AA Change: I178T

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 242 1.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136925
AA Change: I178T

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000119382
Gene: ENSMUSG00000001436
AA Change: I178T

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 426 7.8e-163 PFAM
Pfam:MFS_1 66 405 4.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144234
AA Change: I178T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116784
Gene: ENSMUSG00000001436
AA Change: I178T

DomainStartEndE-ValueType
Pfam:Folate_carrier 23 427 3e-167 PFAM
Pfam:MFS_1 66 406 2.6e-13 PFAM
Meta Mutation Damage Score 0.1104 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.0%
  • 20x: 91.8%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane protein encoded by this gene is a transporter of folate and is involved in the regulation of intracellular concentrations of folate. Three transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null embryos die due to abnormalities of hematopoietic organs. Mutant mice may be partially rescued with maternal folic acid supplementation, but these mice still present with hematopoietic organ defects and show impaired development of urogenital structures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,803 Y179F probably benign Het
Abcd4 A G 12: 84,612,899 probably benign Het
Abhd12b C T 12: 70,181,017 T191M probably benign Het
Adcy5 A G 16: 35,156,178 E27G possibly damaging Het
Adgb G A 10: 10,407,158 probably benign Het
Afdn T C 17: 13,884,637 S1186P probably damaging Het
Atf6b G T 17: 34,651,626 R351L probably damaging Het
Axin2 T C 11: 108,939,397 S348P possibly damaging Het
BC030499 T C 11: 78,291,681 probably benign Het
Bfsp1 A C 2: 143,827,643 probably null Het
Brd1 A G 15: 88,730,383 V103A probably benign Het
Ccdc13 C A 9: 121,813,481 K392N probably damaging Het
Ccdc18 A G 5: 108,173,761 K577R probably damaging Het
Csmd2 G T 4: 128,496,029 G2186C probably damaging Het
Cyp2j5 A T 4: 96,629,523 M484K probably benign Het
Defb3 T A 8: 19,293,407 L12Q probably null Het
Defb7 G T 8: 19,495,170 probably null Het
Dhx35 T A 2: 158,840,620 M491K probably damaging Het
Dnah17 T C 11: 118,074,434 S2261G possibly damaging Het
Dnah5 A C 15: 28,263,679 E853D probably benign Het
Dner C A 1: 84,583,053 A23S probably benign Het
Dock5 A C 14: 67,819,641 S539A probably benign Het
Dsg2 T A 18: 20,583,042 F317I probably benign Het
Enox1 A T 14: 77,699,198 I539F possibly damaging Het
Eogt G A 6: 97,135,284 probably benign Het
Fbxo22 A G 9: 55,223,346 T300A probably benign Het
Fes T C 7: 80,384,005 D166G probably damaging Het
Fn1 A G 1: 71,609,653 S1366P probably damaging Het
Fndc3a A T 14: 72,540,495 probably benign Het
Foxh1 T C 15: 76,669,010 H168R probably benign Het
Galnt14 T G 17: 73,574,984 probably benign Het
Gdf6 A G 4: 9,844,482 D2G probably damaging Het
Gp6 C A 7: 4,370,184 A247S probably benign Het
Gp6 G C 7: 4,371,627 P232A probably benign Het
Grin2c A G 11: 115,251,134 Y820H probably damaging Het
Gtf2h4 T C 17: 35,670,448 T198A possibly damaging Het
Helz T C 11: 107,672,948 probably benign Het
Htr1d A G 4: 136,443,000 E180G probably benign Het
Igsf10 A G 3: 59,326,008 V1768A probably benign Het
Ints10 A T 8: 68,827,302 T694S probably damaging Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
Lipc T A 9: 70,820,427 Y131F probably damaging Het
Litaf G T 16: 10,966,511 T45K probably damaging Het
Lmo7 A T 14: 101,887,193 R363* probably null Het
Lrrc37a A T 11: 103,500,913 Y1229N probably benign Het
Man2a2 C T 7: 80,358,276 A943T probably damaging Het
Mtor A G 4: 148,480,923 Y1030C probably damaging Het
Naalad2 G T 9: 18,351,447 Y384* probably null Het
Nat2 C T 8: 67,501,726 Q163* probably null Het
Nell2 A G 15: 95,431,681 probably benign Het
Nphp3 C T 9: 104,037,348 H102Y possibly damaging Het
Olfr1383 A T 11: 49,524,134 H137L possibly damaging Het
Olfr1442 C T 19: 12,674,757 T184I probably benign Het
Olfr686 A T 7: 105,203,659 M228K probably benign Het
Olr1 T C 6: 129,488,906 S46G possibly damaging Het
Parg C A 14: 32,202,433 A63E probably damaging Het
Pik3cg A G 12: 32,195,715 probably benign Het
Ripk4 A G 16: 97,743,561 C629R probably benign Het
Rnf145 A G 11: 44,564,151 T620A probably benign Het
Samd9l T G 6: 3,376,031 D410A possibly damaging Het
Serpinb9f A T 13: 33,327,951 probably benign Het
Slco1b2 A T 6: 141,671,111 Y390F probably benign Het
Speg A G 1: 75,385,032 E230G possibly damaging Het
Tbc1d9 C A 8: 83,264,837 probably benign Het
Tmem131l G A 3: 83,940,587 Q324* probably null Het
Trf A G 9: 103,226,956 probably benign Het
Trp53 T G 11: 69,588,679 Y202D probably damaging Het
Trpv1 T A 11: 73,253,272 M618K probably damaging Het
Trrap C A 5: 144,822,761 Y2250* probably null Het
Ttc3 A G 16: 94,385,322 probably benign Het
Ubtfl1 T G 9: 18,409,787 S204A probably benign Het
Uck2 A T 1: 167,227,771 Y203N probably damaging Het
Utrn A T 10: 12,686,465 L1280* probably null Het
Vmn1r178 A T 7: 23,894,184 H146L possibly damaging Het
Vmn2r100 C A 17: 19,522,120 P252Q possibly damaging Het
Vmn2r108 T C 17: 20,471,635 M209V probably benign Het
Vmn2r9 G A 5: 108,843,125 T790I probably damaging Het
Vmn2r94 C A 17: 18,243,604 R808L probably benign Het
Zbtb7c A T 18: 76,136,891 S17C probably damaging Het
Zfp811 C T 17: 32,797,764 R434Q probably damaging Het
Zkscan6 A T 11: 65,814,863 probably benign Het
Other mutations in Slc19a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0211:Slc19a1 UTSW 10 77038466 missense possibly damaging 0.92
R0419:Slc19a1 UTSW 10 77042908 missense probably damaging 1.00
R1459:Slc19a1 UTSW 10 77042535 nonsense probably null
R1725:Slc19a1 UTSW 10 77041838 missense probably benign 0.03
R2202:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2203:Slc19a1 UTSW 10 77041924 missense possibly damaging 0.71
R2221:Slc19a1 UTSW 10 77042486 missense probably benign 0.00
R3861:Slc19a1 UTSW 10 77041975 missense possibly damaging 0.88
R3968:Slc19a1 UTSW 10 77041846 missense probably damaging 1.00
R5800:Slc19a1 UTSW 10 77042269 missense probably null 0.00
R6106:Slc19a1 UTSW 10 77044769 missense probably damaging 1.00
R6501:Slc19a1 UTSW 10 77049606 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AACGAGATCATTCCGATGCTGCCC -3'
(R):5'- GCCGAGCATTTTCCACCAGTTCAC -3'

Sequencing Primer
(F):5'- GATACAAGCCAGTCTTGGTCC -3'
(R):5'- AAGGAGTCCCTGCAAGTGC -3'
Posted On2013-04-11