Incidental Mutation 'R1836:Tuba4a'
ID205242
Institutional Source Beutler Lab
Gene Symbol Tuba4a
Ensembl Gene ENSMUSG00000026202
Gene Nametubulin, alpha 4A
SynonymsTuba4, M[a]4
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.350) question?
Stock #R1836 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location75214228-75219865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75216110 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 287 (S287P)
Ref Sequence ENSEMBL: ENSMUSP00000140657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000179573] [ENSMUST00000180101] [ENSMUST00000186213] [ENSMUST00000186758] [ENSMUST00000188460] [ENSMUST00000188593] [ENSMUST00000189131] [ENSMUST00000189698] [ENSMUST00000190717] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079464
AA Change: S315P
SMART Domains Protein: ENSMUSP00000078429
Gene: ENSMUSG00000026202
AA Change: S315P

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect probably benign
Transcript: ENSMUST00000179573
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably benign
Transcript: ENSMUST00000186213
AA Change: S287P

PolyPhen 2 Score 0.203 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140657
Gene: ENSMUSG00000026202
AA Change: S287P

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect probably benign
Transcript: ENSMUST00000186758
SMART Domains Protein: ENSMUSP00000140552
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 100 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187103
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188593
SMART Domains Protein: ENSMUSP00000140881
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 2 75 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189131
SMART Domains Protein: ENSMUSP00000140970
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 81 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190717
SMART Domains Protein: ENSMUSP00000141097
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 89 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Tuba4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Tuba4a APN 1 75217277 missense probably damaging 1.00
andropov UTSW 1 75217394 missense probably damaging 1.00
R0453:Tuba4a UTSW 1 75215858 missense probably damaging 1.00
R0573:Tuba4a UTSW 1 75216373 missense probably benign 0.01
R1488:Tuba4a UTSW 1 75216401 missense probably benign 0.08
R1660:Tuba4a UTSW 1 75215903 missense probably benign 0.35
R2012:Tuba4a UTSW 1 75216339 nonsense probably null
R2437:Tuba4a UTSW 1 75217425 missense possibly damaging 0.47
R4180:Tuba4a UTSW 1 75215782 missense probably benign 0.33
R5505:Tuba4a UTSW 1 75216416 missense probably damaging 1.00
R6137:Tuba4a UTSW 1 75216055 missense probably damaging 1.00
R6189:Tuba4a UTSW 1 75216874 missense probably benign 0.34
R6566:Tuba4a UTSW 1 75217286 missense probably damaging 1.00
R6837:Tuba4a UTSW 1 75217394 missense probably damaging 1.00
R6883:Tuba4a UTSW 1 75217422 missense probably damaging 1.00
R7213:Tuba4a UTSW 1 75215697 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AAACTGGATGCTGCGCTTCG -3'
(R):5'- TGATATCTGCCGCCGTAACC -3'

Sequencing Primer
(F):5'- CGCTTCGTCTTGATGGCAGC -3'
(R):5'- GCCGTAACCTAGATATTGAGCGTC -3'
Posted On2014-06-23