Incidental Mutation 'R1836:Ncf2'
ID205246
Institutional Source Beutler Lab
Gene Symbol Ncf2
Ensembl Gene ENSMUSG00000026480
Gene Nameneutrophil cytosolic factor 2
SynonymsNOXA2, p67phox, Ncf-2, NADPH oxidase subunit (67kDa)
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1836 (G1)
Quality Score193
Status Not validated
Chromosome1
Chromosomal Location152800194-152836991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 152808071 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 14 (V14M)
Ref Sequence ENSEMBL: ENSMUSP00000140404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027754] [ENSMUST00000186568] [ENSMUST00000190323]
Predicted Effect probably damaging
Transcript: ENSMUST00000027754
AA Change: V14M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027754
Gene: ENSMUSG00000026480
AA Change: V14M

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186568
AA Change: V14M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140404
Gene: ENSMUSG00000026480
AA Change: V14M

DomainStartEndE-ValueType
TPR 37 70 1.42e0 SMART
TPR 71 104 3.58e-6 SMART
TPR 121 154 1.05e1 SMART
SH3 243 298 1.02e-13 SMART
low complexity region 312 326 N/A INTRINSIC
PB1 350 428 2.6e-10 SMART
SH3 459 514 8.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189135
Predicted Effect probably benign
Transcript: ENSMUST00000190323
SMART Domains Protein: ENSMUSP00000139774
Gene: ENSMUSG00000026480

DomainStartEndE-ValueType
Pfam:TPR_1 1 26 5.8e-4 PFAM
low complexity region 54 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes neutrophil cytosolic factor 2, the 67-kilodalton cytosolic subunit of the multi-protein NADPH oxidase complex found in neutrophils. This oxidase produces a burst of superoxide which is delivered to the lumen of the neutrophil phagosome. Mutations in this gene, as well as in other NADPH oxidase subunits, can result in chronic granulomatous disease, a disease that causes recurrent infections by catalase-positive organisms. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Ncf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Ncf2 APN 1 152808174 missense possibly damaging 0.49
IGL00952:Ncf2 APN 1 152836106 missense probably benign 0.19
IGL01504:Ncf2 APN 1 152833329 missense probably benign 0.00
IGL01693:Ncf2 APN 1 152824323 missense probably benign 0.00
IGL02005:Ncf2 APN 1 152817052 missense possibly damaging 0.73
IGL02041:Ncf2 APN 1 152836120 utr 3 prime probably benign
IGL02327:Ncf2 APN 1 152816993 missense possibly damaging 0.49
IGL02366:Ncf2 APN 1 152835073 missense probably benign
IGL02627:Ncf2 APN 1 152811008 splice site probably benign
R0560:Ncf2 UTSW 1 152821522 missense probably damaging 1.00
R1136:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R1640:Ncf2 UTSW 1 152808033 start codon destroyed probably null 1.00
R1673:Ncf2 UTSW 1 152830479 missense probably benign 0.13
R1873:Ncf2 UTSW 1 152825910 missense probably benign 0.00
R1940:Ncf2 UTSW 1 152834064 splice site probably benign
R1967:Ncf2 UTSW 1 152830372 missense probably damaging 1.00
R3405:Ncf2 UTSW 1 152825947 unclassified probably benign
R3406:Ncf2 UTSW 1 152825947 unclassified probably benign
R4501:Ncf2 UTSW 1 152835033 missense probably benign 0.00
R4503:Ncf2 UTSW 1 152833778 missense probably benign 0.20
R4563:Ncf2 UTSW 1 152808225 intron probably benign
R5841:Ncf2 UTSW 1 152821518 splice site silent
R6336:Ncf2 UTSW 1 152834070 missense probably damaging 1.00
R6385:Ncf2 UTSW 1 152830422 missense probably benign 0.00
R6522:Ncf2 UTSW 1 152827463 critical splice donor site probably null
R6811:Ncf2 UTSW 1 152836040 missense probably benign 0.00
R7048:Ncf2 UTSW 1 152808170 missense probably benign
X0066:Ncf2 UTSW 1 152810979 start codon destroyed probably null 0.27
Predicted Primers PCR Primer
(F):5'- ACTTCCTGACGCTACGAAGTC -3'
(R):5'- CAATTAGTTGGGGCCTCTGAGG -3'

Sequencing Primer
(F):5'- CTACGAAGTCGCCCAAAGGG -3'
(R):5'- ATGAGGTTTCCAGAGGCGG -3'
Posted On2014-06-23