Incidental Mutation 'R1836:Tle3'
ID205301
Institutional Source Beutler Lab
Gene Symbol Tle3
Ensembl Gene ENSMUSG00000032280
Gene Nametransducin-like enhancer of split 3
Synonyms2610103N05Rik, ESG, Grg3a, Grg3b
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1836 (G1)
Quality Score205
Status Not validated
Chromosome9
Chromosomal Location61372366-61418497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61414023 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 639 (D639G)
Ref Sequence ENSEMBL: ENSMUSP00000124173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034820] [ENSMUST00000159050] [ENSMUST00000159386] [ENSMUST00000159630] [ENSMUST00000160882] [ENSMUST00000161207] [ENSMUST00000161689] [ENSMUST00000161993] [ENSMUST00000162127] [ENSMUST00000162583] [ENSMUST00000162973] [ENSMUST00000178113]
Predicted Effect probably damaging
Transcript: ENSMUST00000034820
AA Change: D631G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034820
Gene: ENSMUSG00000032280
AA Change: D631G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 4.3e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 468 505 2.96e-2 SMART
WD40 511 552 4.48e-2 SMART
WD40 557 596 2.84e-4 SMART
WD40 599 638 7.55e-9 SMART
WD40 641 679 3.07e1 SMART
WD40 681 720 4.18e-2 SMART
WD40 721 761 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159050
AA Change: D634G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125032
Gene: ENSMUSG00000032280
AA Change: D634G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 471 508 2.96e-2 SMART
WD40 514 555 4.48e-2 SMART
WD40 560 599 2.84e-4 SMART
WD40 602 641 7.55e-9 SMART
WD40 644 682 3.07e1 SMART
WD40 684 723 4.18e-2 SMART
WD40 724 764 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159140
Predicted Effect probably damaging
Transcript: ENSMUST00000159386
AA Change: D627G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125049
Gene: ENSMUSG00000032280
AA Change: D627G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 2.1e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 464 501 2.96e-2 SMART
WD40 507 548 4.48e-2 SMART
WD40 553 592 2.84e-4 SMART
WD40 595 634 7.55e-9 SMART
WD40 637 675 3.07e1 SMART
WD40 677 716 4.18e-2 SMART
WD40 717 757 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159630
AA Change: D579G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123723
Gene: ENSMUSG00000032280
AA Change: D579G

DomainStartEndE-ValueType
Pfam:TLE_N 1 79 1.7e-43 PFAM
low complexity region 104 122 N/A INTRINSIC
low complexity region 138 150 N/A INTRINSIC
low complexity region 226 245 N/A INTRINSIC
WD40 416 453 2.96e-2 SMART
WD40 459 500 4.48e-2 SMART
WD40 505 544 2.84e-4 SMART
WD40 547 586 7.55e-9 SMART
WD40 589 627 3.07e1 SMART
WD40 629 668 4.18e-2 SMART
WD40 669 709 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160882
AA Change: D649G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124131
Gene: ENSMUSG00000032280
AA Change: D649G

DomainStartEndE-ValueType
Pfam:TLE_N 1 146 4.8e-76 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 205 217 N/A INTRINSIC
low complexity region 293 312 N/A INTRINSIC
WD40 486 523 2.96e-2 SMART
WD40 529 570 4.48e-2 SMART
WD40 575 614 2.84e-4 SMART
WD40 617 656 7.55e-9 SMART
WD40 659 697 3.07e1 SMART
WD40 699 738 4.18e-2 SMART
WD40 739 779 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161207
AA Change: D629G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124557
Gene: ENSMUSG00000032280
AA Change: D629G

DomainStartEndE-ValueType
Pfam:TLE_N 1 129 1e-73 PFAM
low complexity region 154 172 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 276 295 N/A INTRINSIC
WD40 466 503 2.96e-2 SMART
WD40 509 550 4.48e-2 SMART
WD40 555 594 2.84e-4 SMART
WD40 597 636 7.55e-9 SMART
WD40 639 677 3.07e1 SMART
WD40 679 718 4.18e-2 SMART
WD40 719 759 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000161689
AA Change: D583G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125011
Gene: ENSMUSG00000032280
AA Change: D583G

DomainStartEndE-ValueType
Pfam:TLE_N 1 80 4.8e-44 PFAM
low complexity region 105 123 N/A INTRINSIC
low complexity region 139 151 N/A INTRINSIC
low complexity region 227 246 N/A INTRINSIC
WD40 420 457 2.96e-2 SMART
WD40 463 504 4.48e-2 SMART
WD40 509 548 2.84e-4 SMART
WD40 551 590 7.55e-9 SMART
WD40 593 631 3.07e1 SMART
WD40 633 672 4.18e-2 SMART
WD40 673 713 1.79e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161993
SMART Domains Protein: ENSMUSP00000124432
Gene: ENSMUSG00000032280

DomainStartEndE-ValueType
Pfam:TLE_N 1 135 2e-77 PFAM
low complexity region 160 178 N/A INTRINSIC
low complexity region 194 206 N/A INTRINSIC
low complexity region 282 301 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162127
AA Change: D569G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124150
Gene: ENSMUSG00000032280
AA Change: D569G

DomainStartEndE-ValueType
Pfam:TLE_N 1 83 1.2e-37 PFAM
low complexity region 108 126 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
low complexity region 230 249 N/A INTRINSIC
WD40 406 443 2.96e-2 SMART
WD40 449 490 4.48e-2 SMART
WD40 495 534 2.84e-4 SMART
WD40 537 576 7.55e-9 SMART
WD40 579 617 3.07e1 SMART
WD40 619 658 4.18e-2 SMART
WD40 659 699 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162281
Predicted Effect probably damaging
Transcript: ENSMUST00000162583
AA Change: D636G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124977
Gene: ENSMUSG00000032280
AA Change: D636G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 473 510 2.96e-2 SMART
WD40 516 557 4.48e-2 SMART
WD40 562 601 2.84e-4 SMART
WD40 604 643 7.55e-9 SMART
WD40 646 684 3.07e1 SMART
WD40 686 725 4.18e-2 SMART
WD40 726 766 1.79e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162962
Predicted Effect probably damaging
Transcript: ENSMUST00000162973
AA Change: D639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124173
Gene: ENSMUSG00000032280
AA Change: D639G

DomainStartEndE-ValueType
Pfam:TLE_N 1 136 3.9e-77 PFAM
low complexity region 161 179 N/A INTRINSIC
low complexity region 195 207 N/A INTRINSIC
low complexity region 283 302 N/A INTRINSIC
WD40 476 513 2.96e-2 SMART
WD40 519 560 4.48e-2 SMART
WD40 565 604 2.84e-4 SMART
WD40 607 646 7.55e-9 SMART
WD40 649 687 3.07e1 SMART
WD40 689 728 4.18e-2 SMART
WD40 729 769 1.79e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000178113
AA Change: D650G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000136010
Gene: ENSMUSG00000032280
AA Change: D650G

DomainStartEndE-ValueType
Pfam:TLE_N 1 143 6e-73 PFAM
low complexity region 171 189 N/A INTRINSIC
low complexity region 204 218 N/A INTRINSIC
low complexity region 294 313 N/A INTRINSIC
WD40 487 524 2.96e-2 SMART
WD40 530 571 4.48e-2 SMART
WD40 576 615 2.84e-4 SMART
WD40 618 657 7.55e-9 SMART
WD40 660 698 3.07e1 SMART
WD40 700 739 4.18e-2 SMART
WD40 740 780 1.79e-1 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional co-repressor protein that belongs to the transducin-like enhancer family of proteins. The members of this family function in the Notch signaling pathway that regulates determination of cell fate during development. Expression of this gene has been associated with a favorable outcome to chemotherapy with taxanes for ovarian carcinoma. Alternate splicing results in multiple transcript variants. Additional alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homzoygous for a gene trap allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Birc6 T A 17: 74,614,390 S2155T probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Tle3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Tle3 APN 9 61408757 splice site probably benign
IGL00671:Tle3 APN 9 61412370 missense probably damaging 1.00
IGL01583:Tle3 APN 9 61410025 missense probably benign 0.00
IGL01684:Tle3 APN 9 61403446 intron probably benign
IGL02109:Tle3 APN 9 61413050 missense probably damaging 1.00
IGL02386:Tle3 APN 9 61394659 missense possibly damaging 0.88
IGL02517:Tle3 APN 9 61414781 missense probably damaging 1.00
IGL02930:Tle3 APN 9 61394699 missense possibly damaging 0.52
IGL03103:Tle3 APN 9 61393242 missense possibly damaging 0.46
R0391:Tle3 UTSW 9 61416661 missense probably damaging 1.00
R0395:Tle3 UTSW 9 61410071 missense probably damaging 0.99
R0621:Tle3 UTSW 9 61410105 nonsense probably null
R1921:Tle3 UTSW 9 61411340 critical splice donor site probably null
R1978:Tle3 UTSW 9 61394633 missense probably damaging 1.00
R3434:Tle3 UTSW 9 61414094 unclassified probably null
R4242:Tle3 UTSW 9 61407423 missense probably benign
R4587:Tle3 UTSW 9 61374013 missense probably damaging 0.99
R4811:Tle3 UTSW 9 61373997 unclassified probably benign
R4877:Tle3 UTSW 9 61373499 intron probably benign
R4913:Tle3 UTSW 9 61373993 missense probably damaging 1.00
R5387:Tle3 UTSW 9 61407489 intron probably null
R5745:Tle3 UTSW 9 61414851 missense probably damaging 1.00
R5752:Tle3 UTSW 9 61407471 missense probably damaging 1.00
R5917:Tle3 UTSW 9 61408908 missense probably benign 0.19
R6000:Tle3 UTSW 9 61374014 missense probably damaging 1.00
R6339:Tle3 UTSW 9 61401924 synonymous probably null
R7210:Tle3 UTSW 9 61412305 missense probably damaging 1.00
R7460:Tle3 UTSW 9 61413084 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGTTTTGAGACACGTGATCCAG -3'
(R):5'- AAGCAACCTTCCCGGATTGG -3'

Sequencing Primer
(F):5'- AGACACGTGATCCAGTGTTTTGTAC -3'
(R):5'- TTCCCGGATTGGCTCGG -3'
Posted On2014-06-23