Incidental Mutation 'R1836:Birc6'
ID205350
Institutional Source Beutler Lab
Gene Symbol Birc6
Ensembl Gene ENSMUSG00000024073
Gene Namebaculoviral IAP repeat-containing 6
SynonymsD630005A10Rik, apollon, Bruce, A430032G04Rik, A430040A19Rik
MMRRC Submission 039863-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1836 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location74528295-74703356 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 74614390 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 2155 (S2155T)
Ref Sequence ENSEMBL: ENSMUSP00000138693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180037] [ENSMUST00000182133] [ENSMUST00000182278] [ENSMUST00000182597] [ENSMUST00000182845] [ENSMUST00000182944] [ENSMUST00000183224]
Predicted Effect unknown
Transcript: ENSMUST00000177957
AA Change: S854T
Predicted Effect probably benign
Transcript: ENSMUST00000180037
AA Change: S2161T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000136329
Gene: ENSMUSG00000024073
AA Change: S2161T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2253 2266 N/A INTRINSIC
low complexity region 2491 2505 N/A INTRINSIC
low complexity region 2671 2688 N/A INTRINSIC
low complexity region 2893 2905 N/A INTRINSIC
low complexity region 2958 2970 N/A INTRINSIC
Pfam:DUF3643 3477 3632 1e-69 PFAM
low complexity region 3747 3772 N/A INTRINSIC
low complexity region 3900 3919 N/A INTRINSIC
low complexity region 3940 3958 N/A INTRINSIC
low complexity region 3963 3972 N/A INTRINSIC
low complexity region 4146 4157 N/A INTRINSIC
low complexity region 4307 4318 N/A INTRINSIC
low complexity region 4433 4444 N/A INTRINSIC
UBCc 4592 4756 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181387
Predicted Effect probably benign
Transcript: ENSMUST00000182133
AA Change: S2155T

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138693
Gene: ENSMUSG00000024073
AA Change: S2155T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2055 N/A INTRINSIC
low complexity region 2136 2157 N/A INTRINSIC
low complexity region 2247 2260 N/A INTRINSIC
low complexity region 2485 2499 N/A INTRINSIC
low complexity region 2665 2682 N/A INTRINSIC
low complexity region 2887 2899 N/A INTRINSIC
low complexity region 2952 2964 N/A INTRINSIC
Pfam:DUF3643 3470 3626 2.1e-71 PFAM
low complexity region 3741 3766 N/A INTRINSIC
low complexity region 3894 3913 N/A INTRINSIC
low complexity region 3934 3952 N/A INTRINSIC
low complexity region 3957 3966 N/A INTRINSIC
low complexity region 4140 4151 N/A INTRINSIC
low complexity region 4301 4312 N/A INTRINSIC
low complexity region 4427 4438 N/A INTRINSIC
UBCc 4586 4750 1.04e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182164
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182206
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182221
Predicted Effect probably benign
Transcript: ENSMUST00000182278
AA Change: S241T

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000138343
Gene: ENSMUSG00000024073
AA Change: S241T

DomainStartEndE-ValueType
low complexity region 79 84 N/A INTRINSIC
low complexity region 130 141 N/A INTRINSIC
low complexity region 222 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182597
AA Change: S2161T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138333
Gene: ENSMUSG00000024073
AA Change: S2161T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1620 1675 N/A INTRINSIC
low complexity region 1709 1726 N/A INTRINSIC
low complexity region 1993 1998 N/A INTRINSIC
low complexity region 2044 2059 N/A INTRINSIC
low complexity region 2142 2163 N/A INTRINSIC
low complexity region 2262 2275 N/A INTRINSIC
low complexity region 2500 2514 N/A INTRINSIC
low complexity region 2680 2697 N/A INTRINSIC
low complexity region 2902 2914 N/A INTRINSIC
low complexity region 2967 2979 N/A INTRINSIC
Pfam:DUF3643 3485 3641 2.2e-71 PFAM
low complexity region 3756 3781 N/A INTRINSIC
low complexity region 3909 3928 N/A INTRINSIC
low complexity region 3949 3967 N/A INTRINSIC
low complexity region 3972 3981 N/A INTRINSIC
low complexity region 4155 4166 N/A INTRINSIC
low complexity region 4316 4327 N/A INTRINSIC
low complexity region 4442 4453 N/A INTRINSIC
UBCc 4601 4765 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182845
AA Change: S334T

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138717
Gene: ENSMUSG00000024073
AA Change: S334T

DomainStartEndE-ValueType
low complexity region 166 171 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
low complexity region 315 336 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182944
AA Change: S2157T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138732
Gene: ENSMUSG00000024073
AA Change: S2157T

DomainStartEndE-ValueType
low complexity region 24 54 N/A INTRINSIC
BIR 287 363 2.87e-24 SMART
low complexity region 472 493 N/A INTRINSIC
low complexity region 624 635 N/A INTRINSIC
low complexity region 674 685 N/A INTRINSIC
low complexity region 769 781 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1369 1380 N/A INTRINSIC
coiled coil region 1616 1671 N/A INTRINSIC
low complexity region 1705 1722 N/A INTRINSIC
low complexity region 1989 1994 N/A INTRINSIC
low complexity region 2040 2055 N/A INTRINSIC
low complexity region 2138 2159 N/A INTRINSIC
low complexity region 2249 2262 N/A INTRINSIC
low complexity region 2487 2501 N/A INTRINSIC
low complexity region 2667 2684 N/A INTRINSIC
low complexity region 2889 2901 N/A INTRINSIC
low complexity region 2954 2966 N/A INTRINSIC
Pfam:DUF3643 3472 3628 3.2e-71 PFAM
low complexity region 3743 3768 N/A INTRINSIC
low complexity region 3896 3915 N/A INTRINSIC
low complexity region 3936 3954 N/A INTRINSIC
low complexity region 3959 3968 N/A INTRINSIC
low complexity region 4142 4153 N/A INTRINSIC
low complexity region 4303 4314 N/A INTRINSIC
low complexity region 4429 4440 N/A INTRINSIC
UBCc 4588 4752 1.04e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183224
AA Change: S2141T

PolyPhen 2 Score 0.285 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000138270
Gene: ENSMUSG00000024073
AA Change: S2141T

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
BIR 259 335 2.87e-24 SMART
low complexity region 444 465 N/A INTRINSIC
low complexity region 596 607 N/A INTRINSIC
low complexity region 646 657 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
low complexity region 1026 1043 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
coiled coil region 1606 1661 N/A INTRINSIC
low complexity region 1695 1712 N/A INTRINSIC
low complexity region 1979 1984 N/A INTRINSIC
low complexity region 2030 2041 N/A INTRINSIC
low complexity region 2122 2143 N/A INTRINSIC
low complexity region 2233 2246 N/A INTRINSIC
low complexity region 2471 2485 N/A INTRINSIC
low complexity region 2651 2668 N/A INTRINSIC
low complexity region 2873 2885 N/A INTRINSIC
low complexity region 2938 2950 N/A INTRINSIC
Pfam:DUF3643 3456 3612 3.2e-71 PFAM
low complexity region 3727 3752 N/A INTRINSIC
low complexity region 3880 3899 N/A INTRINSIC
low complexity region 3920 3938 N/A INTRINSIC
low complexity region 3943 3952 N/A INTRINSIC
low complexity region 4126 4137 N/A INTRINSIC
low complexity region 4287 4298 N/A INTRINSIC
low complexity region 4413 4424 N/A INTRINSIC
UBCc 4572 4736 1.04e-25 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with a BIR (baculoviral inhibition of apoptosis protein repeat) domain and a UBCc (ubiquitin-conjugating enzyme E2, catalytic) domain. This protein inhibits apoptosis by facilitating the degradation of apoptotic proteins by ubiquitination. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice exhibit perinatal lethality and exhibit placental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029P11Rik T C 15: 81,980,867 V103A probably damaging Het
2210408I21Rik A G 13: 77,323,374 E966G probably benign Het
7420426K07Rik C A 9: 98,903,482 R67S probably benign Het
9330159F19Rik T C 10: 29,221,799 V64A probably damaging Het
Abcb5 G T 12: 118,867,961 Q1219K possibly damaging Het
Acox2 A T 14: 8,248,059 C408S possibly damaging Het
Acsf3 T A 8: 122,780,183 Y72N probably damaging Het
Acss2 T A 2: 155,558,630 Y530N probably damaging Het
Adam28 T C 14: 68,649,421 E48G possibly damaging Het
Adgrv1 A C 13: 81,504,113 M2957R probably benign Het
Adi1 C A 12: 28,679,563 D138E probably benign Het
Alk A C 17: 71,891,037 L1228R probably damaging Het
Alms1 T A 6: 85,678,503 S3344T possibly damaging Het
Aox2 G A 1: 58,308,991 A623T probably benign Het
Arhgef2 C T 3: 88,639,459 T545I probably damaging Het
Atp8a2 T A 14: 60,006,366 N630I possibly damaging Het
Bcl9 G T 3: 97,205,870 Q1090K probably damaging Het
Bdp1 A G 13: 100,035,145 S2152P probably benign Het
Camk2b T C 11: 5,972,384 E488G probably damaging Het
Capn9 T A 8: 124,605,565 probably null Het
Cd209f A G 8: 4,104,491 S119P probably damaging Het
Cep78 T C 19: 15,969,169 E433G probably damaging Het
Chid1 G T 7: 141,526,496 probably null Het
Cldnd2 T C 7: 43,442,925 S129P possibly damaging Het
Cobll1 A T 2: 65,126,236 F289Y probably damaging Het
Creb1 C T 1: 64,550,950 Q32* probably null Het
Creb3l4 G T 3: 90,238,903 S182Y probably benign Het
Dgcr2 A T 16: 17,849,720 C292S probably damaging Het
Dnah8 T C 17: 30,874,927 V4665A possibly damaging Het
Dnah9 A T 11: 66,118,841 M740K probably benign Het
Dnmt1 G A 9: 20,918,246 T687I probably damaging Het
Ece1 C T 4: 137,958,001 R601W probably damaging Het
Echdc2 C A 4: 108,165,535 R3S probably damaging Het
Ep400 A T 5: 110,705,054 L1275Q unknown Het
Epha6 A T 16: 60,205,745 W445R probably damaging Het
Ercc5 T A 1: 44,180,875 S1102R probably benign Het
Fam228a T G 12: 4,715,620 T264P probably damaging Het
Fzd6 T A 15: 39,033,920 I488N probably damaging Het
Gabrg3 T G 7: 56,729,641 N338H probably damaging Het
Gde1 A G 7: 118,695,134 F39L possibly damaging Het
Gjb3 G A 4: 127,326,431 R103W probably damaging Het
Gm4781 T A 10: 100,396,720 noncoding transcript Het
Gm4846 T A 1: 166,483,923 T456S probably benign Het
Gm5415 T G 1: 32,545,677 D384A probably damaging Het
Gpx5 A G 13: 21,287,454 I193T probably benign Het
Herc2 A T 7: 56,155,105 K2294* probably null Het
Hist1h3b T A 13: 23,752,732 V118D probably damaging Het
Iqgap3 T A 3: 88,108,368 V19D probably damaging Het
Itga5 T C 15: 103,346,014 I1006V probably damaging Het
Lamb1 C T 12: 31,301,094 T781I probably benign Het
Lias A G 5: 65,392,343 T57A probably benign Het
Lin37 C A 7: 30,556,943 R108L probably damaging Het
Lrrd1 A T 5: 3,865,709 T769S probably benign Het
Mamstr T C 7: 45,644,963 W414R probably damaging Het
Mtmr11 T G 3: 96,164,786 S233R probably damaging Het
Myh1 A T 11: 67,204,822 I266F probably damaging Het
Myt1 C A 2: 181,797,275 Q197K probably benign Het
Naip5 G T 13: 100,219,687 T1140K probably benign Het
Ncf2 G A 1: 152,808,071 V14M probably damaging Het
Nhsl1 G T 10: 18,524,905 R626S possibly damaging Het
Nol12 T A 15: 78,937,889 V108E probably damaging Het
Nr1i2 G T 16: 38,249,282 P420Q probably damaging Het
Nup155 A G 15: 8,154,980 I1286M possibly damaging Het
Ocrl T A X: 47,962,116 I74N probably damaging Het
Olfr1257 A C 2: 89,881,285 H153P probably damaging Het
Olfr64 A G 7: 103,893,385 S117P probably damaging Het
Olfr993 A G 2: 85,414,405 V158A probably benign Het
Pard3b C T 1: 62,637,604 S999L probably benign Het
Pax9 A G 12: 56,700,054 E225G probably benign Het
Pdcd4 T G 19: 53,926,219 L335R probably damaging Het
Pdgfra T A 5: 75,183,014 M732K possibly damaging Het
Pkhd1 G T 1: 20,117,069 Q3672K probably benign Het
Pold2 A G 11: 5,873,454 L325P possibly damaging Het
Pom121l2 A T 13: 21,983,784 T742S probably benign Het
Ppfia1 C T 7: 144,519,631 E208K probably benign Het
Prex2 A T 1: 11,136,780 R521W probably damaging Het
Rhpn2 T C 7: 35,372,388 L226P probably benign Het
Rps12 C A 10: 23,785,629 D95Y probably damaging Het
Sardh T A 2: 27,215,182 D643V possibly damaging Het
Sars T C 3: 108,435,944 D77G probably benign Het
Scin C A 12: 40,124,698 V129F probably damaging Het
Sftpa1 T A 14: 41,132,846 M66K possibly damaging Het
Sgo1 T C 17: 53,687,771 K28E probably damaging Het
Sim2 G T 16: 94,123,577 probably null Het
Srp54b T A 12: 55,250,160 probably null Het
Stard7 T C 2: 127,295,560 V310A probably benign Het
Tasp1 T C 2: 139,951,557 D233G probably damaging Het
Tdrd6 G T 17: 43,625,589 L1523M probably benign Het
Tle3 A G 9: 61,414,023 D639G probably damaging Het
Tmem128 A G 5: 38,260,406 D2G probably damaging Het
Tmem163 A G 1: 127,677,509 S41P probably benign Het
Ttn C T 2: 76,729,161 S29632N probably damaging Het
Tuba4a A G 1: 75,216,110 S287P probably benign Het
Ubn1 G C 16: 5,077,391 G767A probably benign Het
Ugdh A T 5: 65,420,291 C288* probably null Het
Upf2 T A 2: 6,050,324 probably null Het
Vmn1r2 T C 4: 3,172,836 S252P probably damaging Het
Vmn1r28 A C 6: 58,265,252 T27P probably damaging Het
Vmn1r77 T C 7: 12,041,411 I38T probably benign Het
Vmn2r51 C A 7: 10,098,163 E499* probably null Het
Vmn2r51 G T 7: 10,098,164 Y498* probably null Het
Vmn2r53 A T 7: 12,600,885 W283R probably damaging Het
Vpreb1 T A 16: 16,869,069 T15S probably benign Het
Vps13b T C 15: 35,910,232 S3381P probably damaging Het
Wnt2 A T 6: 18,023,235 D138E probably damaging Het
Zdhhc22 A G 12: 86,983,430 V248A probably benign Het
Zfp30 T A 7: 29,793,380 I434N probably damaging Het
Zfp316 A G 5: 143,253,423 L947P probably damaging Het
Other mutations in Birc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Birc6 APN 17 74573563 splice site probably benign
IGL00542:Birc6 APN 17 74623771 unclassified probably null
IGL00659:Birc6 APN 17 74660653 missense probably damaging 1.00
IGL00710:Birc6 APN 17 74609089 missense probably benign 0.37
IGL00806:Birc6 APN 17 74611529 missense possibly damaging 0.85
IGL00848:Birc6 APN 17 74696393 nonsense probably null
IGL01071:Birc6 APN 17 74566132 missense possibly damaging 0.84
IGL01071:Birc6 APN 17 74631701 missense probably damaging 1.00
IGL01121:Birc6 APN 17 74631038 missense probably benign 0.08
IGL01132:Birc6 APN 17 74603060 missense probably damaging 1.00
IGL01323:Birc6 APN 17 74622925 missense probably damaging 1.00
IGL01444:Birc6 APN 17 74631687 missense probably damaging 1.00
IGL01511:Birc6 APN 17 74627003 nonsense probably null
IGL01576:Birc6 APN 17 74677370 missense possibly damaging 0.80
IGL01578:Birc6 APN 17 74648197 missense probably benign 0.08
IGL01649:Birc6 APN 17 74604546 missense probably benign 0.03
IGL01657:Birc6 APN 17 74660611 missense probably damaging 1.00
IGL01739:Birc6 APN 17 74659221 missense probably benign
IGL01756:Birc6 APN 17 74640208 missense probably benign 0.00
IGL01807:Birc6 APN 17 74631037 missense probably benign
IGL01885:Birc6 APN 17 74604516 missense possibly damaging 0.51
IGL01906:Birc6 APN 17 74638358 missense probably damaging 1.00
IGL01915:Birc6 APN 17 74631720 missense probably benign 0.34
IGL01998:Birc6 APN 17 74579885 missense probably benign 0.06
IGL02084:Birc6 APN 17 74608282 missense probably benign 0.45
IGL02086:Birc6 APN 17 74639827 missense probably damaging 1.00
IGL02161:Birc6 APN 17 74548837 missense probably damaging 0.99
IGL02195:Birc6 APN 17 74697381 splice site probably benign
IGL02283:Birc6 APN 17 74599940 missense probably benign
IGL02476:Birc6 APN 17 74696391 missense possibly damaging 0.81
IGL02493:Birc6 APN 17 74652059 unclassified probably benign
IGL02547:Birc6 APN 17 74579645 missense probably benign 0.21
IGL02678:Birc6 APN 17 74649903 missense probably damaging 1.00
IGL02713:Birc6 APN 17 74579324 missense probably benign
IGL02851:Birc6 APN 17 74609189 missense probably damaging 1.00
IGL02875:Birc6 APN 17 74589718 missense probably damaging 1.00
IGL02985:Birc6 APN 17 74640190 missense probably benign 0.00
IGL03004:Birc6 APN 17 74612185 missense probably benign 0.10
IGL03053:Birc6 APN 17 74565972 missense probably damaging 1.00
IGL03085:Birc6 APN 17 74596950 missense probably damaging 0.97
IGL03109:Birc6 APN 17 74579334 missense possibly damaging 0.71
IGL03143:Birc6 APN 17 74598999 missense possibly damaging 0.89
IGL03180:Birc6 APN 17 74659231 missense probably benign
IGL03221:Birc6 APN 17 74627007 missense probably benign 0.00
IGL03230:Birc6 APN 17 74611070 missense probably damaging 1.00
IGL03294:Birc6 APN 17 74649886 missense probably benign 0.02
IGL03399:Birc6 APN 17 74594373 missense probably benign 0.01
Badlands UTSW 17 74603036 missense probably damaging 1.00
Black_hills UTSW 17 74692332 missense probably damaging 1.00
bottomlands UTSW 17 74609659 missense probably damaging 1.00
Sempervirens UTSW 17 74642504 missense probably damaging 1.00
E0370:Birc6 UTSW 17 74677357 missense probably damaging 1.00
PIT4494001:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R0081:Birc6 UTSW 17 74643441 missense probably benign 0.01
R0086:Birc6 UTSW 17 74593166 missense possibly damaging 0.54
R0089:Birc6 UTSW 17 74638376 missense possibly damaging 0.90
R0116:Birc6 UTSW 17 74623746 splice site probably benign
R0129:Birc6 UTSW 17 74528760 missense probably benign 0.05
R0196:Birc6 UTSW 17 74580287 missense possibly damaging 0.57
R0201:Birc6 UTSW 17 74609327 missense possibly damaging 0.92
R0207:Birc6 UTSW 17 74662832 splice site probably benign
R0295:Birc6 UTSW 17 74613362 intron probably benign
R0386:Birc6 UTSW 17 74599340 missense probably damaging 0.99
R0423:Birc6 UTSW 17 74696297 missense probably damaging 1.00
R0449:Birc6 UTSW 17 74692295 missense probably damaging 1.00
R0453:Birc6 UTSW 17 74649754 missense probably damaging 1.00
R0457:Birc6 UTSW 17 74652028 missense probably benign
R0457:Birc6 UTSW 17 74662625 missense probably damaging 1.00
R0564:Birc6 UTSW 17 74625243 splice site probably benign
R0575:Birc6 UTSW 17 74689237 missense probably damaging 1.00
R0582:Birc6 UTSW 17 74643337 missense probably damaging 1.00
R0624:Birc6 UTSW 17 74580349 missense probably benign 0.20
R0973:Birc6 UTSW 17 74565861 missense probably damaging 0.99
R1061:Birc6 UTSW 17 74689312 missense probably damaging 1.00
R1378:Birc6 UTSW 17 74660455 missense probably damaging 1.00
R1402:Birc6 UTSW 17 74697533 splice site probably benign
R1436:Birc6 UTSW 17 74652705 missense probably damaging 1.00
R1456:Birc6 UTSW 17 74609290 missense probably benign 0.35
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1465:Birc6 UTSW 17 74623858 missense probably benign 0.03
R1474:Birc6 UTSW 17 74579678 missense probably damaging 0.98
R1479:Birc6 UTSW 17 74634853 missense probably damaging 1.00
R1486:Birc6 UTSW 17 74639820 missense probably damaging 1.00
R1499:Birc6 UTSW 17 74612319 missense probably damaging 1.00
R1515:Birc6 UTSW 17 74528636 nonsense probably null
R1549:Birc6 UTSW 17 74662742 missense probably damaging 1.00
R1559:Birc6 UTSW 17 74692237 missense probably damaging 1.00
R1573:Birc6 UTSW 17 74660690 splice site probably benign
R1615:Birc6 UTSW 17 74609409 intron probably null
R1621:Birc6 UTSW 17 74670250 missense probably benign
R1680:Birc6 UTSW 17 74548746 missense probably benign 0.01
R1743:Birc6 UTSW 17 74579756 missense possibly damaging 0.95
R1774:Birc6 UTSW 17 74640013 missense probably damaging 1.00
R1775:Birc6 UTSW 17 74612286 missense probably damaging 1.00
R1818:Birc6 UTSW 17 74649849 missense probably damaging 1.00
R1931:Birc6 UTSW 17 74565982 missense probably damaging 0.99
R1939:Birc6 UTSW 17 74670337 missense probably damaging 1.00
R1964:Birc6 UTSW 17 74634885 missense possibly damaging 0.94
R1994:Birc6 UTSW 17 74598062 missense probably benign 0.01
R2000:Birc6 UTSW 17 74604619 missense possibly damaging 0.46
R2042:Birc6 UTSW 17 74609659 missense probably damaging 1.00
R2090:Birc6 UTSW 17 74662796 missense probably benign
R2130:Birc6 UTSW 17 74659154 splice site probably benign
R2144:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2145:Birc6 UTSW 17 74660413 missense possibly damaging 0.71
R2166:Birc6 UTSW 17 74635795 missense probably benign 0.02
R2180:Birc6 UTSW 17 74612151 missense probably benign 0.03
R2271:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2272:Birc6 UTSW 17 74602971 missense probably benign 0.06
R2416:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R2420:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2421:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2422:Birc6 UTSW 17 74660614 missense probably damaging 1.00
R2513:Birc6 UTSW 17 74647729 missense probably damaging 0.97
R2912:Birc6 UTSW 17 74692206 missense probably damaging 1.00
R3024:Birc6 UTSW 17 74608219 missense possibly damaging 0.83
R3771:Birc6 UTSW 17 74618429 splice site probably benign
R3772:Birc6 UTSW 17 74618429 splice site probably benign
R3829:Birc6 UTSW 17 74655178 missense probably damaging 1.00
R3913:Birc6 UTSW 17 74573613 nonsense probably null
R3915:Birc6 UTSW 17 74579608 missense probably benign 0.12
R3921:Birc6 UTSW 17 74627019 missense probably damaging 0.98
R3928:Birc6 UTSW 17 74611175 missense possibly damaging 0.91
R3928:Birc6 UTSW 17 74638409 missense probably damaging 1.00
R4111:Birc6 UTSW 17 74566015 missense probably damaging 1.00
R4155:Birc6 UTSW 17 74596939 missense probably benign 0.00
R4163:Birc6 UTSW 17 74626980 missense probably damaging 1.00
R4226:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4227:Birc6 UTSW 17 74619840 critical splice donor site probably null
R4358:Birc6 UTSW 17 74619668 intron probably null
R4524:Birc6 UTSW 17 74641777 missense probably damaging 1.00
R4605:Birc6 UTSW 17 74639934 missense probably damaging 1.00
R4619:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4620:Birc6 UTSW 17 74640150 missense probably benign 0.18
R4762:Birc6 UTSW 17 74629489 missense probably damaging 1.00
R4814:Birc6 UTSW 17 74649672 missense probably damaging 1.00
R4849:Birc6 UTSW 17 74647388 missense probably damaging 0.99
R4869:Birc6 UTSW 17 74586012 missense probably benign 0.05
R4912:Birc6 UTSW 17 74565905 missense probably damaging 1.00
R4921:Birc6 UTSW 17 74650099 missense probably damaging 1.00
R4942:Birc6 UTSW 17 74623050 missense probably damaging 1.00
R4954:Birc6 UTSW 17 74612031 missense probably damaging 1.00
R4992:Birc6 UTSW 17 74689256 missense probably benign 0.44
R4994:Birc6 UTSW 17 74594324 intron probably benign
R5018:Birc6 UTSW 17 74640059 missense probably damaging 1.00
R5022:Birc6 UTSW 17 74692332 missense probably damaging 1.00
R5054:Birc6 UTSW 17 74655325 missense probably damaging 1.00
R5068:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5069:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5070:Birc6 UTSW 17 74565972 missense probably damaging 1.00
R5196:Birc6 UTSW 17 74606141 splice site probably benign
R5209:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5212:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5216:Birc6 UTSW 17 74613470 missense probably damaging 1.00
R5279:Birc6 UTSW 17 74650047 missense probably damaging 0.98
R5286:Birc6 UTSW 17 74670247 missense probably damaging 1.00
R5399:Birc6 UTSW 17 74604578 missense possibly damaging 0.75
R5482:Birc6 UTSW 17 74641782 missense possibly damaging 0.86
R5482:Birc6 UTSW 17 74662690 missense probably damaging 1.00
R5492:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5504:Birc6 UTSW 17 74655213 missense probably damaging 1.00
R5519:Birc6 UTSW 17 74580178 missense probably benign
R5544:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5608:Birc6 UTSW 17 74613544 missense probably damaging 0.99
R5623:Birc6 UTSW 17 74528656 missense probably damaging 0.99
R5701:Birc6 UTSW 17 74697425 missense possibly damaging 0.59
R5707:Birc6 UTSW 17 74696404 missense probably damaging 1.00
R5715:Birc6 UTSW 17 74631620 missense probably damaging 1.00
R5734:Birc6 UTSW 17 74618424 splice site probably benign
R5792:Birc6 UTSW 17 74631053 missense probably benign 0.05
R5809:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5810:Birc6 UTSW 17 74670374 missense probably damaging 1.00
R5813:Birc6 UTSW 17 74646502 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599237 missense probably damaging 1.00
R5933:Birc6 UTSW 17 74599238 missense probably damaging 0.98
R5960:Birc6 UTSW 17 74528765 missense probably damaging 0.97
R5961:Birc6 UTSW 17 74646601 missense probably damaging 1.00
R5967:Birc6 UTSW 17 74660439 missense probably damaging 0.99
R5970:Birc6 UTSW 17 74618502 missense possibly damaging 0.95
R5977:Birc6 UTSW 17 74603036 missense probably damaging 1.00
R5982:Birc6 UTSW 17 74648158 missense probably benign
R6023:Birc6 UTSW 17 74654377 missense probably benign 0.24
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6034:Birc6 UTSW 17 74615283 missense probably damaging 1.00
R6243:Birc6 UTSW 17 74609387 missense probably damaging 0.96
R6294:Birc6 UTSW 17 74689257 missense probably benign 0.00
R6327:Birc6 UTSW 17 74662779 missense probably damaging 1.00
R6501:Birc6 UTSW 17 74579281 missense probably damaging 1.00
R6810:Birc6 UTSW 17 74612220 missense possibly damaging 0.63
R6822:Birc6 UTSW 17 74580382 missense possibly damaging 0.82
R6822:Birc6 UTSW 17 74598044 missense probably damaging 1.00
R6835:Birc6 UTSW 17 74642504 missense probably damaging 1.00
R6945:Birc6 UTSW 17 74579531 missense probably benign 0.04
R6957:Birc6 UTSW 17 74579491 missense probably benign
R6989:Birc6 UTSW 17 74630989 missense probably benign 0.18
R6991:Birc6 UTSW 17 74562095 missense probably damaging 1.00
R7019:Birc6 UTSW 17 74609345 missense probably benign 0.01
R7092:Birc6 UTSW 17 74646745 missense probably damaging 1.00
R7158:Birc6 UTSW 17 74594376 missense probably benign 0.25
R7204:Birc6 UTSW 17 74640108 missense probably damaging 1.00
R7267:Birc6 UTSW 17 74585985 missense probably benign 0.00
R7316:Birc6 UTSW 17 74604494 missense probably damaging 0.99
Z1088:Birc6 UTSW 17 74611542 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGGCAAACATGCTTTATAACAGTTCC -3'
(R):5'- GCTCAAATGAAACCTATCACTGG -3'

Sequencing Primer
(F):5'- ACATGCTTTATAACAGTTCCTATGTG -3'
(R):5'- GCAGCCTGGTCTACATAATGAGC -3'
Posted On2014-06-23