Incidental Mutation 'R1837:Slc45a1'
ID205382
Institutional Source Beutler Lab
Gene Symbol Slc45a1
Ensembl Gene ENSMUSG00000039838
Gene Namesolute carrier family 45, member 1
SynonymsDnb5
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location150628572-150652174 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 150638459 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 323 (G323S)
Ref Sequence ENSEMBL: ENSMUSP00000112737 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037827] [ENSMUST00000117997]
Predicted Effect probably benign
Transcript: ENSMUST00000037827
AA Change: G323S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036774
Gene: ENSMUSG00000039838
AA Change: G323S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 86 310 7.3e-11 PFAM
Pfam:MFS_1 92 356 1.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
transmembrane domain 680 702 N/A INTRINSIC
transmembrane domain 712 734 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117997
AA Change: G323S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112737
Gene: ENSMUSG00000039838
AA Change: G323S

DomainStartEndE-ValueType
low complexity region 58 69 N/A INTRINSIC
Pfam:MFS_2 87 307 1.6e-12 PFAM
Pfam:MFS_1 92 362 2.4e-12 PFAM
transmembrane domain 529 551 N/A INTRINSIC
transmembrane domain 575 597 N/A INTRINSIC
transmembrane domain 604 626 N/A INTRINSIC
transmembrane domain 631 653 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147706
Meta Mutation Damage Score 0.04 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was isolated initially from a region on chromosome 1p that is frequently deleted in human neuroblastoma, although no causal relationship has since been demonstrated. The encoded protein belongs to the glycoside-pentoside-hexuronide cation symporter transporter family and may play a role in glucose uptake. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Slc45a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Slc45a1 APN 4 150643969 missense probably damaging 1.00
IGL02009:Slc45a1 APN 4 150637990 missense probably damaging 1.00
IGL02251:Slc45a1 APN 4 150638719 splice site probably benign
IGL02752:Slc45a1 APN 4 150638021 missense probably benign 0.01
IGL02881:Slc45a1 APN 4 150638530 missense probably benign 0.36
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0017:Slc45a1 UTSW 4 150629566 missense possibly damaging 0.56
R0449:Slc45a1 UTSW 4 150643305 missense probably damaging 1.00
R0756:Slc45a1 UTSW 4 150642597 frame shift probably null
R1435:Slc45a1 UTSW 4 150644048 missense probably damaging 1.00
R1943:Slc45a1 UTSW 4 150644277 missense probably benign 0.02
R2186:Slc45a1 UTSW 4 150638251 missense probably benign 0.01
R3766:Slc45a1 UTSW 4 150638060 missense probably damaging 1.00
R4689:Slc45a1 UTSW 4 150638539 missense probably benign 0.31
R4697:Slc45a1 UTSW 4 150638284 missense probably damaging 1.00
R4709:Slc45a1 UTSW 4 150638240 missense probably benign 0.04
R5253:Slc45a1 UTSW 4 150638270 missense probably damaging 0.98
R5387:Slc45a1 UTSW 4 150643909 intron probably benign
R5914:Slc45a1 UTSW 4 150629540 missense possibly damaging 0.57
R6259:Slc45a1 UTSW 4 150638360 missense possibly damaging 0.63
R6290:Slc45a1 UTSW 4 150642639 missense probably damaging 1.00
R6961:Slc45a1 UTSW 4 150629653 missense probably damaging 0.99
R6981:Slc45a1 UTSW 4 150638594 missense possibly damaging 0.48
X0026:Slc45a1 UTSW 4 150644050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACGCTGTCTATGTTGGAGG -3'
(R):5'- TTCTCTCCACAGGTCTTGGAG -3'

Sequencing Primer
(F):5'- GTGCCAAAGGATGATGCGAACTC -3'
(R):5'- TGGGACAAGACCAGCTTCG -3'
Posted On2014-06-23