Incidental Mutation 'R1837:Pdpr'
ID205402
Institutional Source Beutler Lab
Gene Symbol Pdpr
Ensembl Gene ENSMUSG00000033624
Gene Namepyruvate dehydrogenase phosphatase regulatory subunit
Synonyms4930402E16Rik
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111094630-111137074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 111134734 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 787 (P787T)
Ref Sequence ENSEMBL: ENSMUSP00000046639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039333] [ENSMUST00000144377]
Predicted Effect probably damaging
Transcript: ENSMUST00000039333
AA Change: P787T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046639
Gene: ENSMUSG00000033624
AA Change: P787T

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 235 8.3e-8 PFAM
Pfam:DAO 43 401 1.5e-58 PFAM
Pfam:FAO_M 404 459 1.2e-19 PFAM
Pfam:GCV_T 461 738 4.7e-71 PFAM
Pfam:GCV_T_C 746 854 1.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127301
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143719
Predicted Effect probably benign
Transcript: ENSMUST00000144377
SMART Domains Protein: ENSMUSP00000121325
Gene: ENSMUSG00000033624

DomainStartEndE-ValueType
low complexity region 20 35 N/A INTRINSIC
Pfam:FAD_binding_2 43 236 2.4e-8 PFAM
Pfam:DAO 43 401 3.3e-72 PFAM
Pfam:GCV_T 522 667 1.4e-29 PFAM
Meta Mutation Damage Score 0.324 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase complex (PDC) catalyzes the oxidative decarboxylation of pyruvate and links glycolysis to the tricarboxylic acid cycle and fatty acid synthesis. The dephosphorylation and reactivation of PDC is catalyzed by pyruvate dehydrogenase phosphatase (PDP). The dimeric PDP has a catalytic subunit and a regulatory subunit. This gene encodes the FAD-containing regulatory subunit of PDP. The encoded protein acts to decrease the sensitivity of the PDP catalytic subunit to magnesium ions. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Pdpr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Pdpr APN 8 111102072 missense possibly damaging 0.69
IGL01116:Pdpr APN 8 111112710 missense possibly damaging 0.84
IGL01353:Pdpr APN 8 111121278 splice site probably null
IGL01681:Pdpr APN 8 111132936 missense probably damaging 1.00
IGL01785:Pdpr APN 8 111129656 missense probably damaging 0.98
IGL02115:Pdpr APN 8 111103998 missense probably damaging 1.00
IGL02292:Pdpr APN 8 111125680 missense probably damaging 1.00
IGL02749:Pdpr APN 8 111118090 missense probably benign 0.01
IGL03296:Pdpr APN 8 111114798 missense probably damaging 1.00
R0730:Pdpr UTSW 8 111125755 critical splice donor site probably null
R1510:Pdpr UTSW 8 111124475 splice site probably benign
R1838:Pdpr UTSW 8 111134734 missense probably damaging 1.00
R2144:Pdpr UTSW 8 111118036 missense probably damaging 0.97
R4214:Pdpr UTSW 8 111129580 intron probably benign
R4812:Pdpr UTSW 8 111116717 missense probably benign 0.00
R4863:Pdpr UTSW 8 111101951 missense probably benign 0.01
R4998:Pdpr UTSW 8 111114768 missense probably damaging 1.00
R5579:Pdpr UTSW 8 111123816 missense probably damaging 1.00
R5665:Pdpr UTSW 8 111114811 missense possibly damaging 0.55
R5739:Pdpr UTSW 8 111134620 missense possibly damaging 0.78
R6675:Pdpr UTSW 8 111101900 nonsense probably null
R6785:Pdpr UTSW 8 111124611 missense probably benign 0.00
R6889:Pdpr UTSW 8 111124613 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GGAATGTAGTCTAGATGTACCCTC -3'
(R):5'- AACCGATGTCCTGCAATGTC -3'

Sequencing Primer
(F):5'- CCAAGGGCCATCTTATAGACTGG -3'
(R):5'- AACCGATGTCCTGCAATGTCAATTTC -3'
Posted On2014-06-23