Incidental Mutation 'R1837:Yap1'
ID205404
Institutional Source Beutler Lab
Gene Symbol Yap1
Ensembl Gene ENSMUSG00000053110
Gene Nameyes-associated protein 1
SynonymsYki, Yap, yorkie
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location7931999-8004596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7962349 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 139 (Y139N)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065353] [ENSMUST00000086580] [ENSMUST00000173085] [ENSMUST00000173264] [ENSMUST00000174577]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065353
AA Change: Y233N

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000069554
Gene: ENSMUSG00000053110
AA Change: Y233N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 4e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086580
AA Change: Y233N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000083772
Gene: ENSMUSG00000053110
AA Change: Y233N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-68 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173085
AA Change: Y233N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134007
Gene: ENSMUSG00000053110
AA Change: Y233N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173264
AA Change: Y233N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134237
Gene: ENSMUSG00000053110
AA Change: Y233N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 3e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174127
Predicted Effect probably damaging
Transcript: ENSMUST00000174577
AA Change: Y233N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133959
Gene: ENSMUSG00000053110
AA Change: Y233N

DomainStartEndE-ValueType
low complexity region 3 35 N/A INTRINSIC
PDB:3KYS|D 36 156 2e-69 PDB
WW 157 189 5.63e-12 SMART
WW 216 248 8.66e-13 SMART
coiled coil region 283 314 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000174604
AA Change: Y139N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134250
Gene: ENSMUSG00000053110
AA Change: Y139N

DomainStartEndE-ValueType
low complexity region 36 49 N/A INTRINSIC
WW 64 96 5.63e-12 SMART
WW 123 155 8.66e-13 SMART
coiled coil region 191 224 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174760
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes a protein which binds to the SH3 domain of the Yes proto-oncogene product, a tyrosine kinase. This protein contains a WW domain, consisting of four conserved aromatic amino acids including two tryptophan residues. This conserved WW domain is found in various structural, regulatory and signaling molecules in various species, and may play a role in protein-protein interaction. Following cellular damage, phosphorylation of this encoded protein may suppress apoptosis. This protein may be involved in malignant transformation in cancer. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
PHENOTYPE: Embryos homozygous for a null mutation of this gene die between embryonic days E9.5 and E10.5 due to yolk sac avasculogenesis and failure of attachment between the allantois and the chorion. Heterozygous mice are viable, appear normal and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Ggt1 A G 10: 75,579,294 D214G probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Yap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01402:Yap1 APN 9 7934741 splice site probably benign
IGL01404:Yap1 APN 9 7934741 splice site probably benign
IGL02338:Yap1 APN 9 7962281 critical splice donor site probably null
IGL02398:Yap1 APN 9 7950535 missense probably benign 0.06
IGL02793:Yap1 APN 9 7973906 missense probably benign 0.44
Puddel_hunde UTSW 9 8004284 missense probably damaging 1.00
R0410:Yap1 UTSW 9 8001467 missense probably damaging 1.00
R1507:Yap1 UTSW 9 7953140 splice site probably benign
R3968:Yap1 UTSW 9 7973876 missense probably damaging 1.00
R3978:Yap1 UTSW 9 8004284 missense probably damaging 1.00
R4111:Yap1 UTSW 9 7938431 makesense probably null
R4113:Yap1 UTSW 9 7938431 makesense probably null
R4573:Yap1 UTSW 9 7934681 missense probably damaging 1.00
R5028:Yap1 UTSW 9 8001689 missense probably benign 0.05
R6397:Yap1 UTSW 9 8001466 missense probably damaging 1.00
R6407:Yap1 UTSW 9 7962372 missense possibly damaging 0.46
X0020:Yap1 UTSW 9 7938435 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- AAGTTGGGTATACAGCATTTGC -3'
(R):5'- AATCAGTTAGGTGGCCCTGC -3'

Sequencing Primer
(F):5'- GCTACTAAAGGTGTTGCAGATTC -3'
(R):5'- CATAGGCTGTAATCTGTCTTAATGC -3'
Posted On2014-06-23