Incidental Mutation 'R1837:Ggt1'
ID205413
Institutional Source Beutler Lab
Gene Symbol Ggt1
Ensembl Gene ENSMUSG00000006345
Gene Namegamma-glutamyltransferase 1
SynonymsGgtp, CD224, GGT, dwg
MMRRC Submission 039864-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.421) question?
Stock #R1837 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location75561604-75586200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75579294 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 214 (D214G)
Ref Sequence ENSEMBL: ENSMUSP00000117851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006508] [ENSMUST00000124259] [ENSMUST00000125770] [ENSMUST00000128886] [ENSMUST00000129232] [ENSMUST00000131565] [ENSMUST00000134503] [ENSMUST00000139459] [ENSMUST00000140219] [ENSMUST00000141062] [ENSMUST00000143226] [ENSMUST00000143792] [ENSMUST00000145079] [ENSMUST00000145928] [ENSMUST00000151212] [ENSMUST00000152657]
Predicted Effect probably benign
Transcript: ENSMUST00000006508
AA Change: D214G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000006508
Gene: ENSMUSG00000006345
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 4.9e-179 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124259
AA Change: D214G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122616
Gene: ENSMUSG00000006345
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 235 1.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125770
SMART Domains Protein: ENSMUSP00000117968
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 88 7.9e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128886
SMART Domains Protein: ENSMUSP00000118261
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000129020
AA Change: D118G
SMART Domains Protein: ENSMUSP00000118825
Gene: ENSMUSG00000006345
AA Change: D118G

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 263 3.3e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129232
SMART Domains Protein: ENSMUSP00000115118
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 189 9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131565
SMART Domains Protein: ENSMUSP00000119844
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134503
AA Change: D214G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121312
Gene: ENSMUSG00000006345
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 563 1.4e-184 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139459
AA Change: D214G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000121774
Gene: ENSMUSG00000006345
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 243 1.7e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140219
SMART Domains Protein: ENSMUSP00000118870
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 126 2.8e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141062
Predicted Effect probably benign
Transcript: ENSMUST00000143226
SMART Domains Protein: ENSMUSP00000115115
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 190 5.9e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143792
AA Change: D214G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000117851
Gene: ENSMUSG00000006345
AA Change: D214G

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 237 2.2e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145079
SMART Domains Protein: ENSMUSP00000115483
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 110 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145928
SMART Domains Protein: ENSMUSP00000118852
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 210 6.5e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148447
Predicted Effect probably benign
Transcript: ENSMUST00000151212
SMART Domains Protein: ENSMUSP00000119387
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
PDB:4GDX|A 23 60 3e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000152657
SMART Domains Protein: ENSMUSP00000115818
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:G_glu_transpept 54 110 2.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155186
SMART Domains Protein: ENSMUSP00000123017
Gene: ENSMUSG00000006345

DomainStartEndE-ValueType
Pfam:G_glu_transpept 1 128 6.3e-42 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.6%
Validation Efficiency 99% (86/87)
MGI Phenotype FUNCTION: This gene encodes gamma-glutamyl transpeptidase, a plasmamembrane-associated enzyme that cleaves the peptide bond between gamma-glutamyl and cysteinyl glycine moieties of glutathione. The encoded protein is autocatalytically processed to generate an enzymatically active heterodimer comprised of heavy and light chains. Mice lacking the encoded protein grow slowly, develop cataracts and have elevated levels of glutathione in plasma and urine. Transgenic overexpression of the encoded protein in mice enhances osteoclastic bone resorption. The mutant alleles termed 'Dwarf grey' and 'Dwarf grey Bayer' in mice are associated with deletions in this gene. A gamma-glutamyl transpeptidase paralog is located adjacent to this gene. Alternative splicing results in multiple transcript variants. Additional transcripts using alternate promoters and differing in 5' UTRs have been described. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous mutants may exhibit impaired growth, skeletal abnormalities, cataracts, lethargic behavior, premature greying, sterility, and shortened life span. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Actl10 G T 2: 154,553,042 G305W probably damaging Het
Actr3b A T 5: 25,825,159 T74S probably benign Het
Add2 A G 6: 86,118,558 E652G probably damaging Het
Alg9 T A 9: 50,806,315 V83D probably damaging Het
Atp13a2 T A 4: 140,994,332 Y244* probably null Het
BB014433 C G 8: 15,042,629 V75L unknown Het
Bcr A G 10: 75,168,100 probably benign Het
Begain G A 12: 109,035,323 probably benign Het
Bzw1 A G 1: 58,400,118 K67E probably damaging Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Cdc73 T A 1: 143,667,657 T314S possibly damaging Het
Cfap206 T C 4: 34,728,813 T31A probably damaging Het
Cfap58 G A 19: 48,029,139 E813K probably damaging Het
Clstn2 C A 9: 97,583,540 A133S probably benign Het
Col14a1 A T 15: 55,382,495 D465V unknown Het
Col2a1 C T 15: 97,996,641 probably benign Het
Dab2 A G 15: 6,336,476 probably benign Het
Eme1 T C 11: 94,645,961 D464G probably benign Het
Eml6 T C 11: 29,749,802 probably null Het
Ern1 C A 11: 106,458,957 L44F probably damaging Het
Fam111a T A 19: 12,587,452 S188R probably benign Het
Fam151b A T 13: 92,474,131 probably benign Het
Fmo6 T C 1: 162,922,810 N226D probably benign Het
Gm14226 A G 2: 155,025,010 I296V probably benign Het
Gm9915 A T 1: 42,230,687 noncoding transcript Het
Heatr5b T C 17: 78,820,751 D485G possibly damaging Het
Helz2 A T 2: 181,229,289 I2785N probably damaging Het
Htt C T 5: 34,819,023 T723M probably benign Het
Hydin C A 8: 110,569,625 H3595Q probably benign Het
Il6ra T C 3: 89,890,272 D96G probably benign Het
Kif5a G A 10: 127,236,815 Q702* probably null Het
Klhdc7a G T 4: 139,967,070 P189T probably benign Het
Krt7 A G 15: 101,419,582 D252G probably benign Het
Lad1 C A 1: 135,829,706 D394E probably benign Het
Lhx8 A T 3: 154,328,055 C38S possibly damaging Het
Lta4h C T 10: 93,469,175 T280M probably damaging Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med1 G T 11: 98,169,412 D230E probably damaging Het
Mmp1b A T 9: 7,386,409 F171I probably damaging Het
Mprip T C 11: 59,766,745 V801A probably damaging Het
Mtrf1 A G 14: 79,401,833 E135G possibly damaging Het
Muc5ac T A 7: 141,807,086 M1378K probably benign Het
Myo3a A T 2: 22,577,592 Q286L possibly damaging Het
Ndor1 C T 2: 25,248,396 G391R probably damaging Het
Nefl C T 14: 68,086,626 R438C probably damaging Het
Nlrp3 G A 11: 59,548,916 V440I probably benign Het
Notch3 A T 17: 32,124,322 L1959Q probably damaging Het
Noto A G 6: 85,424,177 T63A probably benign Het
Oc90 G A 15: 65,889,680 T163M probably damaging Het
Olfr1219 A T 2: 89,074,832 Y86* probably null Het
Olfr1436 A G 19: 12,298,376 V252A probably damaging Het
Olfr365 T A 2: 37,202,102 M287K probably benign Het
Pdpr C A 8: 111,134,734 P787T probably damaging Het
Phlda1 A G 10: 111,507,231 Q276R probably benign Het
Ptpn21 T G 12: 98,733,626 K10Q probably damaging Het
Ptprb A G 10: 116,341,626 E1364G probably benign Het
Rabep1 T A 11: 70,904,658 W237R probably damaging Het
Rai1 A T 11: 60,189,398 K1429N probably damaging Het
Rapgef1 A G 2: 29,737,426 I1027M probably damaging Het
Rit1 C G 3: 88,729,170 T127S probably damaging Het
Rpap1 A C 2: 119,769,885 probably null Het
Senp7 T A 16: 56,158,516 C471S probably benign Het
Slc16a14 A G 1: 84,912,399 V395A probably benign Het
Slc45a1 C T 4: 150,638,459 G323S probably benign Het
Syne2 A T 12: 75,967,660 E3208D probably damaging Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Ticam1 T C 17: 56,270,799 E432G possibly damaging Het
Tmem192 C A 8: 64,964,340 probably benign Het
Trub1 T C 19: 57,453,029 V28A probably benign Het
Ttc21b A T 2: 66,197,762 L1121H probably benign Het
Ttc38 A G 15: 85,851,563 D290G probably damaging Het
Ulk1 C T 5: 110,789,381 G683D probably damaging Het
Vmn1r122 A T 7: 21,133,366 F255I probably benign Het
Vmn2r68 T A 7: 85,233,678 I289F probably damaging Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Wdr48 T G 9: 119,905,416 S134A probably damaging Het
Yap1 A T 9: 7,962,349 Y139N probably damaging Het
Ylpm1 T C 12: 85,029,333 V486A possibly damaging Het
Zbtb38 T C 9: 96,686,995 T679A probably benign Het
Zfp292 A G 4: 34,810,264 S927P probably damaging Het
Zfp324 C T 7: 12,970,229 T115I probably benign Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp945 A T 17: 22,851,273 C551S probably damaging Het
Zfp958 A G 8: 4,628,590 H205R probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Ggt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Ggt1 APN 10 75584863 missense probably benign 0.15
IGL01593:Ggt1 APN 10 75585287 critical splice donor site probably null
IGL02713:Ggt1 APN 10 75574344 missense probably damaging 1.00
IGL03276:Ggt1 APN 10 75580497 unclassified probably benign
R0373:Ggt1 UTSW 10 75579270 missense probably benign 0.11
R0420:Ggt1 UTSW 10 75576213 splice site probably benign
R0505:Ggt1 UTSW 10 75585957 missense probably damaging 0.99
R0630:Ggt1 UTSW 10 75585502 splice site probably null
R2655:Ggt1 UTSW 10 75581385 nonsense probably null
R2656:Ggt1 UTSW 10 75581385 nonsense probably null
R2910:Ggt1 UTSW 10 75580596 missense probably benign 0.09
R3840:Ggt1 UTSW 10 75581385 nonsense probably null
R3841:Ggt1 UTSW 10 75581385 nonsense probably null
R4744:Ggt1 UTSW 10 75585899 missense probably benign 0.00
R5254:Ggt1 UTSW 10 75579198 unclassified probably null
R5323:Ggt1 UTSW 10 75585661 critical splice acceptor site probably null
R5326:Ggt1 UTSW 10 75585706 critical splice donor site probably null
R5512:Ggt1 UTSW 10 75584884 missense probably damaging 0.99
R5579:Ggt1 UTSW 10 75585948 missense probably damaging 1.00
R5707:Ggt1 UTSW 10 75585238 missense probably benign 0.01
R5961:Ggt1 UTSW 10 75585902 unclassified probably null
R6159:Ggt1 UTSW 10 75584965 missense probably damaging 1.00
R6239:Ggt1 UTSW 10 75585681 unclassified probably null
Predicted Primers PCR Primer
(F):5'- GACAGATTCCACCCGTGTTTC -3'
(R):5'- AAGGGAATCCATGCTGACCC -3'

Sequencing Primer
(F):5'- CTCTTCTGCACCCTGAGGAC -3'
(R):5'- ATTCCCTGAGGACCCAGAG -3'
Posted On2014-06-23