Incidental Mutation 'R1839:Mcm9'
ID205614
Institutional Source Beutler Lab
Gene Symbol Mcm9
Ensembl Gene ENSMUSG00000058298
Gene Nameminichromosome maintenance 9 homologous recombination repair factor
SynonymsMcmdc1, 9030408O17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location53536315-53630439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53541553 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 18 (M18T)
Ref Sequence ENSEMBL: ENSMUSP00000151956 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075540] [ENSMUST00000219547] [ENSMUST00000220007]
Predicted Effect probably damaging
Transcript: ENSMUST00000075540
AA Change: M756T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000074978
Gene: ENSMUSG00000058298
AA Change: M756T

DomainStartEndE-ValueType
low complexity region 22 44 N/A INTRINSIC
low complexity region 62 79 N/A INTRINSIC
low complexity region 81 111 N/A INTRINSIC
MCM 268 761 9.44e-116 SMART
AAA 500 649 2.43e-6 SMART
coiled coil region 789 817 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 1004 1028 N/A INTRINSIC
low complexity region 1045 1056 N/A INTRINSIC
low complexity region 1199 1216 N/A INTRINSIC
low complexity region 1219 1232 N/A INTRINSIC
low complexity region 1246 1255 N/A INTRINSIC
low complexity region 1262 1276 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000219547
AA Change: M18T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000220007
AA Change: M18T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the mini-chromosome maintenance (MCM) protein family that are essential for the initiation of eukaryotic genome replication. Binding of this protein to chromatin has been shown to be a pre-requisite for recruiting the MCM2-7 helicase to DNA replication origins. This protein also binds, and is a positive regulator of, the chromatin licensing and DNA replication factor 1, CDT1. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for gene trap alleles display germ cell loss with reduced fertility or infertility and increased tumor incidence, particulary of hepatocellular carcinomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Ltn1 T A 16: 87,416,264 K470* probably null Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Mcm9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00660:Mcm9 APN 10 53622973 missense probably damaging 0.97
IGL00904:Mcm9 APN 10 53622921 missense possibly damaging 0.89
IGL00943:Mcm9 APN 10 53548589 missense probably damaging 1.00
IGL01019:Mcm9 APN 10 53629945 missense probably damaging 1.00
IGL02452:Mcm9 APN 10 53541557 missense probably damaging 1.00
IGL02481:Mcm9 APN 10 53625937 missense probably damaging 1.00
IGL02982:Mcm9 APN 10 53625826 missense probably damaging 0.99
IGL03300:Mcm9 APN 10 53611427 missense probably damaging 1.00
R0021:Mcm9 UTSW 10 53537901 missense possibly damaging 0.94
R0117:Mcm9 UTSW 10 53537736 missense possibly damaging 0.49
R0137:Mcm9 UTSW 10 53563430 missense possibly damaging 0.95
R0420:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R0499:Mcm9 UTSW 10 53538154 missense probably benign 0.01
R0543:Mcm9 UTSW 10 53541598 missense probably damaging 0.97
R0947:Mcm9 UTSW 10 53537501 small deletion probably benign
R0975:Mcm9 UTSW 10 53538646 nonsense probably null
R1573:Mcm9 UTSW 10 53548656 missense probably damaging 0.97
R1726:Mcm9 UTSW 10 53537881 missense possibly damaging 0.67
R2050:Mcm9 UTSW 10 53612825 critical splice donor site probably null
R2113:Mcm9 UTSW 10 53615847 splice site probably null
R2172:Mcm9 UTSW 10 53548574 missense probably damaging 1.00
R3417:Mcm9 UTSW 10 53537407 missense possibly damaging 0.83
R3755:Mcm9 UTSW 10 53625952 missense probably benign 0.08
R3787:Mcm9 UTSW 10 53615980 missense possibly damaging 0.78
R3789:Mcm9 UTSW 10 53616017 missense probably damaging 1.00
R3953:Mcm9 UTSW 10 53563344 missense probably damaging 1.00
R4291:Mcm9 UTSW 10 53547572 missense probably benign 0.22
R4358:Mcm9 UTSW 10 53537653 missense probably benign 0.03
R4660:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R4662:Mcm9 UTSW 10 53548527 missense probably benign 0.10
R5082:Mcm9 UTSW 10 53538060 missense possibly damaging 0.94
R5130:Mcm9 UTSW 10 53630399 missense possibly damaging 0.90
R5193:Mcm9 UTSW 10 53616038 missense probably damaging 0.99
R5238:Mcm9 UTSW 10 53629997 missense possibly damaging 0.83
R5317:Mcm9 UTSW 10 53538234 missense probably damaging 1.00
R5395:Mcm9 UTSW 10 53538692 missense possibly damaging 0.93
R5524:Mcm9 UTSW 10 53548690 nonsense probably null
R5593:Mcm9 UTSW 10 53538297 missense probably damaging 0.99
R5748:Mcm9 UTSW 10 53625729 missense probably damaging 1.00
R6025:Mcm9 UTSW 10 53615977 missense possibly damaging 0.93
R6299:Mcm9 UTSW 10 53537681 missense probably damaging 1.00
R6344:Mcm9 UTSW 10 53537937 missense probably benign 0.03
R6502:Mcm9 UTSW 10 53612839 missense probably damaging 1.00
R6621:Mcm9 UTSW 10 53563313 missense probably damaging 1.00
R6883:Mcm9 UTSW 10 53616014 missense probably damaging 1.00
R6932:Mcm9 UTSW 10 53620203 missense probably benign 0.06
R6963:Mcm9 UTSW 10 53548617 missense probably damaging 1.00
R7094:Mcm9 UTSW 10 53620157 missense probably damaging 1.00
R7114:Mcm9 UTSW 10 53538573 missense possibly damaging 0.55
R7200:Mcm9 UTSW 10 53615923 missense
Predicted Primers PCR Primer
(F):5'- GCCATGACAGAGTGAAGGTC -3'
(R):5'- AGGCCTCTTATGGAGAAACTGC -3'

Sequencing Primer
(F):5'- AGTGAAGGTCTCTGTCCCCAAC -3'
(R):5'- AAACTGCTCTGAAGGTAGTTGCC -3'
Posted On2014-06-23