Incidental Mutation 'R1839:Ltn1'
ID205645
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1839 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 87416264 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 470 (K470*)
Ref Sequence ENSEMBL: ENSMUSP00000156299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably null
Transcript: ENSMUST00000039449
AA Change: K470*
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: K470*

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083713
Predicted Effect probably null
Transcript: ENSMUST00000232095
AA Change: K470*
Meta Mutation Damage Score 0.58 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.7%
  • 20x: 90.6%
Validation Efficiency 98% (90/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik T C 3: 124,409,720 T403A probably damaging Het
Acat3 T A 17: 12,928,606 R175* probably null Het
Adam1b C A 5: 121,501,041 C647F probably damaging Het
Adam28 T C 14: 68,639,210 N197S possibly damaging Het
Adcy2 C T 13: 68,689,261 probably null Het
Adcy5 A T 16: 35,248,940 N426I probably damaging Het
Adgre1 T C 17: 57,441,299 S500P probably benign Het
Aloxe3 A G 11: 69,130,085 Y212C probably damaging Het
Ap3d1 A G 10: 80,727,108 S180P probably damaging Het
Arhgap20 C T 9: 51,849,326 R790W probably damaging Het
Atp8b4 C A 2: 126,361,782 A757S possibly damaging Het
Begain G A 12: 109,035,323 probably benign Het
Ccdc141 T C 2: 77,011,665 E1474G probably benign Het
Ccdc88b A G 19: 6,854,109 probably benign Het
Ccnk A G 12: 108,195,074 T195A probably damaging Het
Cd55b C A 1: 130,414,105 C265F probably damaging Het
Celsr3 A G 9: 108,829,906 H1196R probably benign Het
Cenpt T C 8: 105,849,014 S190G possibly damaging Het
Chd8 T C 14: 52,204,883 S2077G probably benign Het
Col6a5 G A 9: 105,864,833 H2296Y probably benign Het
Cxxc4 C A 3: 134,240,653 H332N probably damaging Het
Cyp24a1 T C 2: 170,496,741 I12V probably benign Het
Cyp3a57 T A 5: 145,381,301 L364Q probably damaging Het
Ddi2 T C 4: 141,713,526 I47V probably benign Het
Ddx5 A T 11: 106,784,897 D322E probably benign Het
Dhx40 A G 11: 86,789,297 C405R possibly damaging Het
Emc1 T C 4: 139,360,485 F100S probably damaging Het
Exoc2 T C 13: 30,906,497 probably benign Het
Gm10110 A T 14: 89,897,836 noncoding transcript Het
Gm17332 T C 11: 31,182,386 H26R possibly damaging Het
Gna12 T C 5: 140,762,612 N183S probably benign Het
Gpx6 A G 13: 21,312,327 N24D probably benign Het
Gsdma3 C T 11: 98,629,858 A105V probably benign Het
Hsd3b5 T C 3: 98,619,728 Y134C probably benign Het
Ifi213 T C 1: 173,589,600 I415M probably damaging Het
Ints9 C A 14: 65,016,530 P278T probably damaging Het
Krt79 C T 15: 101,937,938 E192K possibly damaging Het
Lrrk2 A G 15: 91,683,134 N132S probably benign Het
Magi2 A T 5: 20,465,827 T163S probably damaging Het
Mcm9 A G 10: 53,541,553 M18T probably damaging Het
Med12l A G 3: 59,068,319 T212A probably benign Het
Mfhas1 T C 8: 35,590,858 L829P possibly damaging Het
Mgme1 T A 2: 144,279,487 C288S probably benign Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myh7 T C 14: 54,973,180 N1725S possibly damaging Het
Nat6 G A 9: 107,583,017 R37H possibly damaging Het
Nme4 A T 17: 26,092,097 W165R probably damaging Het
Nup205 T A 6: 35,219,714 D1128E probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr330 A T 11: 58,529,373 Y204* probably null Het
Pcdh1 T C 18: 38,199,485 D155G possibly damaging Het
Pex12 A T 11: 83,297,822 S116T probably damaging Het
Plekhh1 C T 12: 79,078,957 probably benign Het
Plekhh3 A G 11: 101,163,600 probably benign Het
Pnpt1 T C 11: 29,154,342 M572T possibly damaging Het
Ppp1r12b T C 1: 134,837,981 R667G probably benign Het
Rbpms2 ACTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGCTGC 9: 65,651,666 probably benign Het
Rgs14 T C 13: 55,382,838 probably benign Het
Rhbdf2 A T 11: 116,600,191 V645E possibly damaging Het
Robo3 A G 9: 37,422,327 V696A probably benign Het
Sall1 A G 8: 89,028,716 F1212L possibly damaging Het
Sdc4 T C 2: 164,429,012 E109G probably benign Het
Serpind1 G T 16: 17,342,992 R462L probably damaging Het
Smad9 CTTT CTT 3: 54,789,179 probably benign Het
Sstr4 C A 2: 148,395,533 N21K probably benign Het
Tap1 C T 17: 34,188,109 A77V possibly damaging Het
Thap4 T C 1: 93,750,287 E259G probably benign Het
Thra A G 11: 98,756,143 N30S probably benign Het
Tmem207 A T 16: 26,524,821 V27E possibly damaging Het
Top3a A G 11: 60,753,888 V305A probably damaging Het
Trim59 A T 3: 69,037,638 I123K probably damaging Het
Ttn T C 2: 76,861,495 probably benign Het
Ubac1 T A 2: 26,007,738 E290V possibly damaging Het
Unc13b T C 4: 43,258,308 probably benign Het
Uri1 A T 7: 37,967,389 D206E probably benign Het
Utp4 A G 8: 106,913,454 H465R probably benign Het
Uvssa T C 5: 33,389,752 S221P probably benign Het
Vmn1r39 T C 6: 66,805,233 probably null Het
Vps39 A T 2: 120,325,397 L514H probably damaging Het
Vps72 G A 3: 95,119,218 R158Q possibly damaging Het
Wdr59 T C 8: 111,485,340 D366G probably benign Het
Zfp366 C A 13: 99,228,492 Q54K probably damaging Het
Zfp523 T A 17: 28,194,993 I34N probably damaging Het
Zfp974 G A 7: 27,910,356 P648L possibly damaging Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2109:Ltn1 UTSW 16 87415642 missense probably benign 0.03
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GGTATATTGATGGCAAACCTGACCTG -3'
(R):5'- AGGAGGCTTTATACTGCTTTAACTTTG -3'

Sequencing Primer
(F):5'- GCAAACCTGACCTGAGCAGTTTTC -3'
(R):5'- TCAAAGACTCAGGACTGC -3'
Posted On2014-06-23