Incidental Mutation 'R0113:Galnt5'
ID20568
Institutional Source Beutler Lab
Gene Symbol Galnt5
Ensembl Gene ENSMUSG00000026828
Gene Namepolypeptide N-acetylgalactosaminyltransferase 5
SynonymsppGaNTase-T5
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0113 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location57997884-58045860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57998877 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 163 (E163G)
Ref Sequence ENSEMBL: ENSMUSP00000131362 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]
Predicted Effect probably benign
Transcript: ENSMUST00000112616
AA Change: E163G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: E163G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 1.3e-33 PFAM
Pfam:Glyco_transf_7C 653 718 1.9e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144671
Predicted Effect probably benign
Transcript: ENSMUST00000166729
AA Change: E163G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: E163G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
low complexity region 319 330 N/A INTRINSIC
Pfam:Glycos_transf_2 489 672 2.1e-30 PFAM
Pfam:Glyco_transf_7C 652 718 7e-8 PFAM
RICIN 801 925 1.36e-19 SMART
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A probably benign Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Galnt5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Galnt5 APN 2 57998973 missense probably benign
IGL00515:Galnt5 APN 2 57999068 missense probably benign 0.02
IGL00950:Galnt5 APN 2 57999132 missense probably benign 0.00
IGL00973:Galnt5 APN 2 57998939 missense probably benign 0.02
IGL01152:Galnt5 APN 2 58025393 missense probably benign 0.17
IGL01305:Galnt5 APN 2 58025342 nonsense probably null
IGL01661:Galnt5 APN 2 57999482 missense probably benign 0.03
IGL01719:Galnt5 APN 2 57998543 missense probably damaging 1.00
IGL02165:Galnt5 APN 2 57998865 missense probably benign
IGL02795:Galnt5 APN 2 58027871 missense probably damaging 1.00
IGL02943:Galnt5 APN 2 57999768 missense probably damaging 1.00
IGL03218:Galnt5 APN 2 57999389 missense possibly damaging 0.59
ANU22:Galnt5 UTSW 2 58025342 nonsense probably null
R0082:Galnt5 UTSW 2 57999035 missense possibly damaging 0.92
R0445:Galnt5 UTSW 2 57998950 missense probably benign
R0517:Galnt5 UTSW 2 58035373 splice site probably benign
R0609:Galnt5 UTSW 2 58024625 missense possibly damaging 0.90
R0639:Galnt5 UTSW 2 57999395 missense probably benign 0.07
R0646:Galnt5 UTSW 2 57999085 missense probably benign 0.00
R0677:Galnt5 UTSW 2 57998980 nonsense probably null
R1808:Galnt5 UTSW 2 58026125 missense probably benign 0.24
R1927:Galnt5 UTSW 2 57998603 missense probably benign 0.00
R1980:Galnt5 UTSW 2 58024723 critical splice donor site probably null
R2517:Galnt5 UTSW 2 57999413 missense probably benign 0.00
R4044:Galnt5 UTSW 2 57998460 missense probably damaging 1.00
R4154:Galnt5 UTSW 2 57998493 missense probably damaging 1.00
R4411:Galnt5 UTSW 2 57999195 missense probably benign 0.01
R4703:Galnt5 UTSW 2 57998907 missense possibly damaging 0.96
R4767:Galnt5 UTSW 2 58028144 missense possibly damaging 0.91
R5118:Galnt5 UTSW 2 58015003 missense probably damaging 1.00
R5497:Galnt5 UTSW 2 58025328 missense probably damaging 0.99
R5506:Galnt5 UTSW 2 57999625 missense probably benign
R5548:Galnt5 UTSW 2 58014910 missense probably damaging 0.99
R5758:Galnt5 UTSW 2 57998430 missense probably benign 0.19
R5937:Galnt5 UTSW 2 58038937 missense probably benign 0.00
R6237:Galnt5 UTSW 2 58035249 missense probably damaging 0.96
R6805:Galnt5 UTSW 2 58035299 missense possibly damaging 0.82
R6959:Galnt5 UTSW 2 57999219 missense probably benign 0.39
R7070:Galnt5 UTSW 2 57998609 missense probably benign 0.00
R7179:Galnt5 UTSW 2 57998609 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- AGATCAACGCAGGGCTACTCAAAG -3'
(R):5'- TGGCTGCATCATCTTCTGGCAATC -3'

Sequencing Primer
(F):5'- ATTCAGAGTTGAGCCAGACC -3'
(R):5'- GACTTCCTCAGATTTCAGGATTG -3'
Posted On2013-04-11