Incidental Mutation 'R1840:Ascc3'
ID205721
Institutional Source Beutler Lab
Gene Symbol Ascc3
Ensembl Gene ENSMUSG00000038774
Gene Nameactivating signal cointegrator 1 complex subunit 3
SynonymsB630009I04Rik, ASC1p200, Helic1
MMRRC Submission 039866-MU
Accession Numbers

Ncbi RefSeq: NM_198007.2; MGI:1925237

Is this an essential gene? Probably essential (E-score: 0.956) question?
Stock #R1840 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location50592669-50851485 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50690161 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 734 (M734K)
Ref Sequence ENSEMBL: ENSMUSP00000036726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035606]
Predicted Effect probably benign
Transcript: ENSMUST00000035606
AA Change: M734K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036726
Gene: ENSMUSG00000038774
AA Change: M734K

DomainStartEndE-ValueType
coiled coil region 55 79 N/A INTRINSIC
low complexity region 124 135 N/A INTRINSIC
coiled coil region 329 356 N/A INTRINSIC
DEXDc 474 686 1.71e-29 SMART
AAA 492 674 8.15e-2 SMART
Blast:DEXDc 718 763 4e-18 BLAST
HELICc 770 858 6.01e-16 SMART
Sec63 979 1288 3.53e-111 SMART
DEXDc 1324 1528 8.88e-28 SMART
AAA 1342 1492 4.27e-1 SMART
HELICc 1605 1695 2.28e-16 SMART
Sec63 1813 2178 6.37e-118 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of helicases that are involved in the ATP-dependent unwinding of nucleic acid duplexes. The encoded protein is the largest subunit of the activating signal cointegrator 1 complex that is involved in DNA repair and resistance to alkylation damage. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]
Allele List at MGI

All alleles(16) : Targeted(2) Gene trapped(14)

Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Aatk T G 11: 120,013,732 D206A probably damaging Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Ddx60 T A 8: 61,969,553 I608N probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Epha1 C T 6: 42,363,588 R583H probably damaging Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kif1b C T 4: 149,188,132 R138Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Trpm6 A G 19: 18,866,267 D1665G probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Ascc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Ascc3 APN 10 50714435 missense probably damaging 0.99
IGL00690:Ascc3 APN 10 50699943 nonsense probably null
IGL00897:Ascc3 APN 10 50728091 missense probably benign 0.01
IGL01077:Ascc3 APN 10 50649317 splice site probably benign
IGL01124:Ascc3 APN 10 50732473 missense probably damaging 1.00
IGL01555:Ascc3 APN 10 50750522 missense probably damaging 1.00
IGL02019:Ascc3 APN 10 50690139 missense probably damaging 1.00
IGL02161:Ascc3 APN 10 50850527 nonsense probably null
IGL02247:Ascc3 APN 10 50650590 missense probably damaging 1.00
IGL02318:Ascc3 APN 10 50728154 nonsense probably null
IGL02428:Ascc3 APN 10 50845695 nonsense probably null
IGL02432:Ascc3 APN 10 50700493 missense probably damaging 0.99
IGL02449:Ascc3 APN 10 50700599 missense probably benign 0.00
IGL02640:Ascc3 APN 10 50767374 missense possibly damaging 0.69
IGL02673:Ascc3 APN 10 50660673 missense probably benign 0.01
IGL03144:Ascc3 APN 10 50767443 missense probably benign 0.16
IGL03161:Ascc3 APN 10 50618072 missense probably damaging 0.98
IGL03218:Ascc3 APN 10 50823853 missense possibly damaging 0.89
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0045:Ascc3 UTSW 10 50718402 nonsense probably null
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0131:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0132:Ascc3 UTSW 10 50735329 missense probably damaging 0.99
R0149:Ascc3 UTSW 10 50607993 missense probably benign 0.31
R0165:Ascc3 UTSW 10 50842127 intron probably null
R0255:Ascc3 UTSW 10 50645058 missense probably benign 0.00
R0310:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0314:Ascc3 UTSW 10 50637999 missense possibly damaging 0.92
R0362:Ascc3 UTSW 10 50748955 splice site probably benign
R0418:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0419:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0421:Ascc3 UTSW 10 50748926 missense probably benign 0.02
R0480:Ascc3 UTSW 10 50735252 missense probably damaging 1.00
R0744:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R0833:Ascc3 UTSW 10 50845666 missense probably benign 0.17
R1231:Ascc3 UTSW 10 50823660 missense probably damaging 1.00
R1264:Ascc3 UTSW 10 50642519 splice site probably benign
R1302:Ascc3 UTSW 10 50604794 start codon destroyed probably null 1.00
R1751:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1767:Ascc3 UTSW 10 50718376 missense probably damaging 0.97
R1769:Ascc3 UTSW 10 50700490 missense probably damaging 1.00
R1855:Ascc3 UTSW 10 50617922 missense probably benign 0.01
R1953:Ascc3 UTSW 10 50845630 missense probably benign
R1976:Ascc3 UTSW 10 50649166 missense probably damaging 1.00
R2004:Ascc3 UTSW 10 50617742 missense probably damaging 1.00
R2013:Ascc3 UTSW 10 50649812 missense probably damaging 0.99
R2017:Ascc3 UTSW 10 50690211 missense probably benign 0.00
R2040:Ascc3 UTSW 10 50728131 missense probably benign
R2043:Ascc3 UTSW 10 50700520 missense probably damaging 1.00
R2165:Ascc3 UTSW 10 50721839 missense probably damaging 1.00
R2226:Ascc3 UTSW 10 50754052 missense probably benign 0.07
R2310:Ascc3 UTSW 10 50748892 missense probably benign 0.15
R2405:Ascc3 UTSW 10 50731678 missense probably damaging 1.00
R2424:Ascc3 UTSW 10 50618201 missense probably benign 0.14
R3410:Ascc3 UTSW 10 50700100 missense probably damaging 1.00
R3617:Ascc3 UTSW 10 50618185 missense probably benign 0.00
R3771:Ascc3 UTSW 10 50720718 splice site probably benign
R3783:Ascc3 UTSW 10 50728254 missense probably damaging 1.00
R3891:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R3892:Ascc3 UTSW 10 50842193 missense probably damaging 0.99
R4435:Ascc3 UTSW 10 50721885 missense probably benign 0.14
R4509:Ascc3 UTSW 10 50842243 missense probably benign 0.00
R4520:Ascc3 UTSW 10 50660670 missense probably benign
R4521:Ascc3 UTSW 10 50660670 missense probably benign
R4522:Ascc3 UTSW 10 50660670 missense probably benign
R4524:Ascc3 UTSW 10 50660670 missense probably benign
R4581:Ascc3 UTSW 10 50711025 missense probably damaging 1.00
R4701:Ascc3 UTSW 10 50720664 missense possibly damaging 0.66
R4704:Ascc3 UTSW 10 50659014 missense probably benign 0.02
R4768:Ascc3 UTSW 10 50700499 missense probably damaging 1.00
R4823:Ascc3 UTSW 10 50713233 missense probably damaging 1.00
R4906:Ascc3 UTSW 10 50749131 missense probably damaging 1.00
R4937:Ascc3 UTSW 10 50823798 missense probably damaging 1.00
R5001:Ascc3 UTSW 10 50823648 missense probably damaging 1.00
R5151:Ascc3 UTSW 10 50637963 missense probably damaging 0.99
R5263:Ascc3 UTSW 10 50716661 missense probably benign 0.00
R5302:Ascc3 UTSW 10 50707777 missense probably benign 0.09
R5436:Ascc3 UTSW 10 50658983 missense probably damaging 0.99
R5455:Ascc3 UTSW 10 50849583 missense probably benign 0.06
R5474:Ascc3 UTSW 10 50849538 missense probably benign 0.25
R5744:Ascc3 UTSW 10 50710881 missense probably benign
R5781:Ascc3 UTSW 10 50637978 missense probably damaging 1.00
R5850:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R5867:Ascc3 UTSW 10 50842183 nonsense probably null
R5868:Ascc3 UTSW 10 50842183 nonsense probably null
R5869:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6031:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6032:Ascc3 UTSW 10 50842183 nonsense probably null
R6109:Ascc3 UTSW 10 50649247 missense probably benign 0.37
R6122:Ascc3 UTSW 10 50617925 missense probably benign
R6128:Ascc3 UTSW 10 50650638 missense probably damaging 1.00
R6351:Ascc3 UTSW 10 50720673 missense probably damaging 0.99
R6368:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6369:Ascc3 UTSW 10 50699985 missense probably damaging 1.00
R6409:Ascc3 UTSW 10 50845580 missense probably benign 0.09
R6472:Ascc3 UTSW 10 50720687 missense probably benign 0.03
R6474:Ascc3 UTSW 10 50748836 missense probably benign 0.01
R6480:Ascc3 UTSW 10 50710953 missense probably damaging 1.00
R6553:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6572:Ascc3 UTSW 10 50690247 nonsense probably null
R6585:Ascc3 UTSW 10 50842177 missense probably benign 0.05
R6656:Ascc3 UTSW 10 50649925 nonsense probably null
R6669:Ascc3 UTSW 10 50840373 missense probably benign
R6675:Ascc3 UTSW 10 50750563 nonsense probably null
R6790:Ascc3 UTSW 10 50645712 missense probably damaging 1.00
R6856:Ascc3 UTSW 10 50749062 missense probably damaging 1.00
R6862:Ascc3 UTSW 10 50849646 missense probably null 0.51
R6919:Ascc3 UTSW 10 50645753 nonsense probably null
R6936:Ascc3 UTSW 10 50729961 missense probably damaging 0.98
R6953:Ascc3 UTSW 10 50645666 missense probably benign 0.00
R6957:Ascc3 UTSW 10 50728182 missense probably damaging 1.00
R7022:Ascc3 UTSW 10 50716629 missense possibly damaging 0.55
R7050:Ascc3 UTSW 10 50840350 missense probably benign 0.43
R7358:Ascc3 UTSW 10 50714352 nonsense probably null
R7479:Ascc3 UTSW 10 50649799 missense probably damaging 1.00
X0021:Ascc3 UTSW 10 50700590 missense possibly damaging 0.88
X0025:Ascc3 UTSW 10 50650596 missense probably benign 0.00
X0026:Ascc3 UTSW 10 50732478 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGAATTTTAACTTCCTCTTATCAGG -3'
(R):5'- ATGACTCTAACATTACCTTCTCAGA -3'

Sequencing Primer
(F):5'- ATGTTGGCTAATTCAGAAATTGGAG -3'
(R):5'- ATGCATGTCCGTACTCTG -3'
Posted On2014-06-23