Incidental Mutation 'R0113:Ints1'
ID20576
Institutional Source Beutler Lab
Gene Symbol Ints1
Ensembl Gene ENSMUSG00000029547
Gene Nameintegrator complex subunit 1
Synonyms1110015K06Rik
MMRRC Submission 038399-MU
Accession Numbers

Genbank: NM_026748; MGI: 1915760

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0113 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location139751282-139775674 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139765213 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 810 (T810A)
Ref Sequence ENSEMBL: ENSMUSP00000072406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072607] [ENSMUST00000200393]
Predicted Effect probably benign
Transcript: ENSMUST00000072607
AA Change: T810A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000072406
Gene: ENSMUSG00000029547
AA Change: T810A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196319
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200339
Predicted Effect probably benign
Transcript: ENSMUST00000200393
AA Change: T812A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000143789
Gene: ENSMUSG00000029547
AA Change: T812A

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
low complexity region 88 102 N/A INTRINSIC
Pfam:DUF3677 379 459 6.4e-37 PFAM
low complexity region 854 865 N/A INTRINSIC
low complexity region 870 876 N/A INTRINSIC
low complexity region 946 962 N/A INTRINSIC
low complexity region 965 988 N/A INTRINSIC
low complexity region 1034 1045 N/A INTRINSIC
low complexity region 1058 1069 N/A INTRINSIC
low complexity region 1347 1361 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1615 1624 N/A INTRINSIC
low complexity region 1763 1776 N/A INTRINSIC
low complexity region 1840 1855 N/A INTRINSIC
low complexity region 2062 2076 N/A INTRINSIC
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] INTS1 is a subunit of the Integrator complex, which associates with the C-terminal domain of RNA polymerase II large subunit (POLR2A; MIM 180660) and mediates 3-prime end processing of small nuclear RNAs U1 (RNU1; MIM 180680) and U2 (RNU2; MIM 180690) (Baillat et al., 2005 [PubMed 16239144]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality at the blastocyst stage. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(9)

Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
C4b T A 17: 34,741,240 Y279F probably damaging Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in Ints1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Ints1 APN 5 139771682 missense probably damaging 0.99
IGL01329:Ints1 APN 5 139767503 splice site probably benign
IGL01414:Ints1 APN 5 139758498 missense probably benign
IGL01612:Ints1 APN 5 139756292 missense probably benign 0.17
IGL01726:Ints1 APN 5 139768411 splice site probably benign
IGL01958:Ints1 APN 5 139760088 missense possibly damaging 0.94
IGL02122:Ints1 APN 5 139765150 nonsense probably null
IGL02149:Ints1 APN 5 139751960 missense probably damaging 1.00
IGL02349:Ints1 APN 5 139768468 missense probably damaging 0.96
IGL02557:Ints1 APN 5 139771637 missense probably damaging 1.00
IGL02814:Ints1 APN 5 139772391 missense possibly damaging 0.80
IGL02815:Ints1 APN 5 139755282 missense probably damaging 0.96
IGL02825:Ints1 APN 5 139764739 missense probably benign 0.32
IGL03000:Ints1 APN 5 139766506 missense probably benign 0.01
IGL03164:Ints1 APN 5 139752735 missense probably damaging 0.99
A9681:Ints1 UTSW 5 139770139 missense possibly damaging 0.56
R0193:Ints1 UTSW 5 139751730 missense probably damaging 1.00
R0372:Ints1 UTSW 5 139772438 missense probably damaging 1.00
R1129:Ints1 UTSW 5 139758471 missense probably benign 0.00
R1290:Ints1 UTSW 5 139771410 nonsense probably null
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1313:Ints1 UTSW 5 139762906 missense probably benign
R1691:Ints1 UTSW 5 139768932 missense probably damaging 1.00
R1708:Ints1 UTSW 5 139762839 missense probably damaging 1.00
R1791:Ints1 UTSW 5 139774522 missense probably benign 0.04
R2066:Ints1 UTSW 5 139767496 missense probably benign 0.14
R2102:Ints1 UTSW 5 139755999 missense possibly damaging 0.50
R2108:Ints1 UTSW 5 139767750 missense probably damaging 1.00
R2238:Ints1 UTSW 5 139765200 missense possibly damaging 0.95
R2426:Ints1 UTSW 5 139771814 critical splice donor site probably null
R2913:Ints1 UTSW 5 139757913 missense possibly damaging 0.91
R3896:Ints1 UTSW 5 139757644 nonsense probably null
R4608:Ints1 UTSW 5 139759844 missense probably benign 0.13
R4658:Ints1 UTSW 5 139774299 missense possibly damaging 0.88
R4797:Ints1 UTSW 5 139771876 missense possibly damaging 0.85
R4887:Ints1 UTSW 5 139771156 missense possibly damaging 0.66
R4944:Ints1 UTSW 5 139758092 splice site probably null
R4956:Ints1 UTSW 5 139757130 missense probably damaging 1.00
R4976:Ints1 UTSW 5 139752811 missense probably damaging 1.00
R5283:Ints1 UTSW 5 139764382 missense probably damaging 1.00
R5354:Ints1 UTSW 5 139766428 critical splice donor site probably null
R5496:Ints1 UTSW 5 139755198 missense probably benign 0.07
R5517:Ints1 UTSW 5 139752787 missense possibly damaging 0.86
R5696:Ints1 UTSW 5 139754989 missense probably benign 0.00
R5766:Ints1 UTSW 5 139772145 missense probably benign 0.33
R6359:Ints1 UTSW 5 139756217 missense probably benign 0.09
R6753:Ints1 UTSW 5 139765175 missense probably damaging 1.00
R6892:Ints1 UTSW 5 139767828 missense probably damaging 0.99
R7009:Ints1 UTSW 5 139768462 missense possibly damaging 0.83
R7047:Ints1 UTSW 5 139758471 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCCAAGGTTAGCTCTGCCTGTTC -3'
(R):5'- TCGTCATGCTATGTGAAGTGCCTG -3'

Sequencing Primer
(F):5'- CCTTCCACCCACACCTGG -3'
(R):5'- TTGCAGACACTGGGGCTTAAC -3'
Posted On2013-04-11