Incidental Mutation 'R1840:Trpm6'
ID205779
Institutional Source Beutler Lab
Gene Symbol Trpm6
Ensembl Gene ENSMUSG00000024727
Gene Nametransient receptor potential cation channel, subfamily M, member 6
SynonymsCHAK2
MMRRC Submission 039866-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1840 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location18749983-18892510 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18866267 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1665 (D1665G)
Ref Sequence ENSEMBL: ENSMUSP00000037443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040489]
Predicted Effect probably benign
Transcript: ENSMUST00000040489
AA Change: D1665G

PolyPhen 2 Score 0.211 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000037443
Gene: ENSMUSG00000024727
AA Change: D1665G

DomainStartEndE-ValueType
Blast:ANK 430 459 4e-8 BLAST
low complexity region 580 604 N/A INTRINSIC
transmembrane domain 749 766 N/A INTRINSIC
Pfam:Ion_trans 847 1087 2.8e-13 PFAM
low complexity region 1113 1126 N/A INTRINSIC
low complexity region 1136 1154 N/A INTRINSIC
Pfam:TRPM_tetra 1176 1231 7.5e-27 PFAM
low complexity region 1320 1331 N/A INTRINSIC
low complexity region 1578 1596 N/A INTRINSIC
Blast:Alpha_kinase 1618 1673 9e-11 BLAST
low complexity region 1682 1695 N/A INTRINSIC
Alpha_kinase 1761 1978 1e-84 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 95.2%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predominantly expressed in the kidney and colon, and encodes a protein containing an ion channel domain and a protein kinase domain. It is crucial for magnesium homeostasis, and plays an essential role in epithelial magnesium transport and in the active magnesium absorption in the gut and kidney. Mutations in this gene are associated with hypomagnesemia with secondary hypocalcemia. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic and postnatal lethality with exencephaly, spina bifida occulta, and abnormal brain and facial development. Mice heterozygous for a knock-out allele exhibit some premature death and decreased serummagnesium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 118 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029I15Rik T C 2: 92,383,209 S36P probably benign Het
2510009E07Rik T A 16: 21,653,486 M85L probably benign Het
Aatk T G 11: 120,013,732 D206A probably damaging Het
Agap3 A G 5: 24,500,231 D719G probably damaging Het
Agrn G A 4: 156,167,415 R1797C probably damaging Het
Ascc3 T A 10: 50,690,161 M734K probably benign Het
Asph T A 4: 9,601,340 M136L possibly damaging Het
Atm A T 9: 53,456,530 V2431E probably damaging Het
Atp2b1 A G 10: 99,022,929 H1158R probably benign Het
Atxn7l1 A G 12: 33,371,033 probably null Het
BC024139 G T 15: 76,120,642 S611R probably benign Het
Becn1 C T 11: 101,295,566 G105S probably damaging Het
Bud13 A G 9: 46,286,408 E70G probably damaging Het
Cacul1 A T 19: 60,534,250 L282* probably null Het
Ccar1 T A 10: 62,763,510 K614M probably damaging Het
Cd96 T C 16: 46,099,092 T189A probably benign Het
Cdh5 C A 8: 104,126,616 Y189* probably null Het
Chka A G 19: 3,886,460 N284S probably benign Het
Cntn6 A T 6: 104,774,480 I366F probably damaging Het
Csmd3 C T 15: 47,607,164 G3372E probably damaging Het
Cyp4f16 T C 17: 32,543,006 probably null Het
Dcaf6 A G 1: 165,399,748 V270A probably damaging Het
Ddx60 T A 8: 61,969,553 I608N probably damaging Het
Dnah9 A T 11: 65,834,198 C1849* probably null Het
Eci3 C A 13: 34,960,041 V34L probably benign Het
Epha1 C T 6: 42,363,588 R583H probably damaging Het
Erbin A T 13: 103,834,947 N720K probably benign Het
Eya1 T A 1: 14,229,504 R346* probably null Het
Fam189a1 C A 7: 64,759,195 V484L probably benign Het
Fhdc1 G A 3: 84,445,821 T699I possibly damaging Het
Flvcr2 T C 12: 85,803,221 V427A possibly damaging Het
Fzd9 T A 5: 135,249,571 T487S probably benign Het
Gas2l3 T C 10: 89,422,251 Y160C possibly damaging Het
Gm10264 T C 12: 88,329,411 V53A probably benign Het
Gm10269 T C 18: 20,682,809 K52R probably damaging Het
Gm16432 A G 1: 178,003,015 D30G possibly damaging Het
Gm8674 A T 13: 49,901,765 noncoding transcript Het
Gpr61 A G 3: 108,150,481 V288A possibly damaging Het
Gramd4 T C 15: 86,130,192 probably null Het
Gtpbp4 A G 13: 8,979,464 L403P probably benign Het
H6pd A T 4: 149,982,050 D626E possibly damaging Het
Herc6 T A 6: 57,658,106 L769* probably null Het
Hes5 A G 4: 154,961,254 K58R probably damaging Het
Heyl A G 4: 123,241,390 I59V probably damaging Het
Hpca A G 4: 129,118,600 F48L probably damaging Het
Ice1 C T 13: 70,606,218 R583Q probably benign Het
Ints2 C T 11: 86,233,085 G626R probably damaging Het
Kansl1l T A 1: 66,778,032 I390F probably damaging Het
Kat5 C T 19: 5,609,238 V95M possibly damaging Het
Kcnh4 T A 11: 100,745,341 I827F possibly damaging Het
Kif1b C T 4: 149,188,132 R138Q probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lats1 T A 10: 7,710,939 L955* probably null Het
Ldlrad2 A C 4: 137,572,184 C110G possibly damaging Het
Lgi3 G A 14: 70,534,776 probably null Het
Lingo1 A G 9: 56,620,558 M249T probably benign Het
Lrig3 A T 10: 126,013,389 R993* probably null Het
Lsm14b T A 2: 180,026,728 I74N probably damaging Het
Lyplal1 T A 1: 186,100,217 I114F probably damaging Het
Mmp15 A G 8: 95,365,420 Y86C probably damaging Het
Myh2 A G 11: 67,186,487 E816G probably benign Het
Myo5c A G 9: 75,249,735 N151S probably damaging Het
Nckap1 T A 2: 80,502,250 E1082V possibly damaging Het
Nrg4 A C 9: 55,282,606 probably benign Het
Nrp2 T C 1: 62,738,339 L101P probably damaging Het
Olfr1180 T C 2: 88,412,067 D197G probably benign Het
Olfr126 A T 17: 37,850,748 D52V probably damaging Het
Olfr521 A T 7: 99,767,596 T145S probably benign Het
Olfr638 A G 7: 104,004,117 I281V probably benign Het
Olfr992 G A 2: 85,400,168 R122C probably benign Het
Parp14 T A 16: 35,863,449 E169V probably damaging Het
Pcolce2 G A 9: 95,670,117 R101H probably damaging Het
Pcolce2 A T 9: 95,670,203 N130Y probably benign Het
Plscr1 A T 9: 92,258,074 S5C unknown Het
Plxdc2 T C 2: 16,669,856 V338A probably benign Het
Psg23 T A 7: 18,610,438 N364I possibly damaging Het
Psmg4 A G 13: 34,178,056 E109G probably damaging Het
Ptk2 T C 15: 73,210,884 E908G probably damaging Het
Ptpn14 G A 1: 189,786,851 R26H probably damaging Het
Ranbp2 T A 10: 58,478,766 N1769K probably benign Het
Rbm14 C T 19: 4,801,795 probably benign Het
Rgs7 A T 1: 175,153,148 D103E probably damaging Het
Rmnd5a G A 6: 71,398,455 L80F probably benign Het
Rock2 T A 12: 16,928,989 D93E probably benign Het
Rps6ka6 A G X: 111,420,932 I246T possibly damaging Het
Rubcn T C 16: 32,826,172 M803V possibly damaging Het
Ryr3 T C 2: 112,750,820 Y2889C probably damaging Het
Sall2 T C 14: 52,313,725 N671S probably damaging Het
Selplg T C 5: 113,819,844 T134A possibly damaging Het
Sez6 C A 11: 77,953,717 T122N possibly damaging Het
Slc9b1 T A 3: 135,357,468 D4E unknown Het
Smim18 A G 8: 33,742,348 M81T probably benign Het
Snap91 A T 9: 86,815,465 H281Q probably damaging Het
Sparc C A 11: 55,395,866 C302F probably damaging Het
Spg11 A G 2: 122,101,756 L535P probably damaging Het
Spsb1 G A 4: 149,906,631 T160I probably damaging Het
Stra6 A G 9: 58,140,530 N128S probably benign Het
Strc T C 2: 121,379,296 E182G probably damaging Het
Sult2a6 A G 7: 14,254,829 M2T probably benign Het
Sv2c T C 13: 95,981,844 N499S probably benign Het
Szt2 A T 4: 118,365,657 probably benign Het
Tbx20 A T 9: 24,725,676 S372T probably benign Het
Tcp11l2 T A 10: 84,604,599 S289T probably damaging Het
Tdrd1 A G 19: 56,842,312 E259G probably damaging Het
Thsd7a T A 6: 12,330,974 I1390L probably benign Het
Tln2 G A 9: 67,342,043 R921W probably damaging Het
Tmem126a C A 7: 90,452,884 G36* probably null Het
Tmem245 C T 4: 56,903,947 V606I probably benign Het
Ubac2 T G 14: 121,994,262 V200G probably benign Het
Ubr5 G A 15: 37,980,917 A2372V possibly damaging Het
Ugcg C T 4: 59,219,517 P285S probably damaging Het
Vmn1r9 T C 6: 57,071,537 V199A probably damaging Het
Vmn2r118 T A 17: 55,610,406 K369* probably null Het
Xpnpep3 G T 15: 81,427,353 A87S probably benign Het
Zc3h7a C T 16: 11,161,026 R95H probably damaging Het
Zdhhc11 A G 13: 73,974,652 N169S probably damaging Het
Zfp62 T A 11: 49,216,388 D435E probably damaging Het
Zfyve16 T C 13: 92,511,525 D1007G possibly damaging Het
Other mutations in Trpm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Trpm6 APN 19 18783908 splice site probably benign
IGL00862:Trpm6 APN 19 18827528 missense probably damaging 1.00
IGL01348:Trpm6 APN 19 18877651 missense probably damaging 1.00
IGL01400:Trpm6 APN 19 18825794 nonsense probably null
IGL01451:Trpm6 APN 19 18809569 missense probably damaging 1.00
IGL01508:Trpm6 APN 19 18796530 nonsense probably null
IGL01995:Trpm6 APN 19 18830327 splice site probably benign
IGL02092:Trpm6 APN 19 18772331 missense possibly damaging 0.59
IGL02152:Trpm6 APN 19 18832539 missense possibly damaging 0.93
IGL02294:Trpm6 APN 19 18854063 missense probably benign
IGL02329:Trpm6 APN 19 18854217 missense probably benign 0.17
IGL02366:Trpm6 APN 19 18778510 splice site probably benign
IGL02402:Trpm6 APN 19 18786756 missense probably benign 0.18
IGL02457:Trpm6 APN 19 18825791 missense probably damaging 1.00
IGL02457:Trpm6 APN 19 18827398 nonsense probably null
IGL02684:Trpm6 APN 19 18802207 splice site probably benign
IGL02705:Trpm6 APN 19 18776733 critical splice donor site probably null
IGL02728:Trpm6 APN 19 18809652 missense possibly damaging 0.71
IGL02742:Trpm6 APN 19 18830012 splice site probably benign
IGL02818:Trpm6 APN 19 18866257 missense probably benign 0.04
IGL02836:Trpm6 APN 19 18813482 missense probably damaging 1.00
IGL03119:Trpm6 APN 19 18838017 nonsense probably null
IGL03193:Trpm6 APN 19 18825872 missense possibly damaging 0.94
IGL03227:Trpm6 APN 19 18819119 missense probably benign 0.01
IGL03227:Trpm6 APN 19 18786779 missense probably benign 0.12
IGL03231:Trpm6 APN 19 18819181 missense probably benign
IGL03245:Trpm6 APN 19 18877701 missense probably damaging 1.00
IGL03328:Trpm6 APN 19 18838082 missense possibly damaging 0.94
IGL03341:Trpm6 APN 19 18813486 missense probably benign
P0043:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R0057:Trpm6 UTSW 19 18786755 missense probably benign 0.05
R0115:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R0119:Trpm6 UTSW 19 18832593 missense probably benign 0.05
R0140:Trpm6 UTSW 19 18819194 splice site probably null
R0267:Trpm6 UTSW 19 18823378 missense probably benign
R0350:Trpm6 UTSW 19 18883957 splice site probably null
R0373:Trpm6 UTSW 19 18853587 missense probably benign 0.15
R0393:Trpm6 UTSW 19 18778644 missense probably damaging 0.99
R0416:Trpm6 UTSW 19 18783025 splice site probably benign
R0505:Trpm6 UTSW 19 18873902 splice site probably benign
R0526:Trpm6 UTSW 19 18792876 missense probably damaging 0.97
R0607:Trpm6 UTSW 19 18872221 missense probably benign 0.00
R0609:Trpm6 UTSW 19 18825862 missense probably damaging 0.97
R0714:Trpm6 UTSW 19 18838087 missense possibly damaging 0.90
R1215:Trpm6 UTSW 19 18796498 missense probably damaging 1.00
R1474:Trpm6 UTSW 19 18796495 missense probably benign 0.28
R1512:Trpm6 UTSW 19 18875931 missense probably benign
R1558:Trpm6 UTSW 19 18786828 missense probably benign 0.04
R1597:Trpm6 UTSW 19 18827524 missense probably damaging 0.98
R1618:Trpm6 UTSW 19 18877631 missense possibly damaging 0.88
R1779:Trpm6 UTSW 19 18856217 missense probably damaging 1.00
R1796:Trpm6 UTSW 19 18827567 missense possibly damaging 0.90
R1799:Trpm6 UTSW 19 18891999 splice site probably null
R1991:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2030:Trpm6 UTSW 19 18854265 missense probably benign
R2073:Trpm6 UTSW 19 18876042 missense probably damaging 1.00
R2074:Trpm6 UTSW 19 18877739 missense probably damaging 1.00
R2096:Trpm6 UTSW 19 18825752 missense probably damaging 0.97
R2103:Trpm6 UTSW 19 18796284 missense probably benign 0.00
R2106:Trpm6 UTSW 19 18813350 missense possibly damaging 0.95
R2117:Trpm6 UTSW 19 18829952 missense probably damaging 0.98
R2850:Trpm6 UTSW 19 18792090 missense possibly damaging 0.68
R3125:Trpm6 UTSW 19 18854431 missense probably benign 0.05
R3719:Trpm6 UTSW 19 18772393 nonsense probably null
R3779:Trpm6 UTSW 19 18876039 missense possibly damaging 0.80
R4115:Trpm6 UTSW 19 18832557 missense probably damaging 1.00
R4367:Trpm6 UTSW 19 18827525 missense probably damaging 0.99
R4523:Trpm6 UTSW 19 18796500 missense probably damaging 1.00
R4546:Trpm6 UTSW 19 18832477 missense probably damaging 1.00
R4564:Trpm6 UTSW 19 18832597 missense possibly damaging 0.95
R4565:Trpm6 UTSW 19 18825872 missense probably damaging 1.00
R4697:Trpm6 UTSW 19 18853791 missense probably benign 0.01
R4714:Trpm6 UTSW 19 18854200 missense possibly damaging 0.93
R4750:Trpm6 UTSW 19 18876064 missense probably damaging 0.99
R4771:Trpm6 UTSW 19 18813493 missense probably damaging 0.97
R4791:Trpm6 UTSW 19 18867981 missense probably benign 0.00
R4814:Trpm6 UTSW 19 18862212 missense probably benign 0.11
R5028:Trpm6 UTSW 19 18786760 missense probably damaging 1.00
R5237:Trpm6 UTSW 19 18813464 missense probably damaging 1.00
R5615:Trpm6 UTSW 19 18829933 missense probably damaging 0.96
R5642:Trpm6 UTSW 19 18830207 missense probably damaging 1.00
R5645:Trpm6 UTSW 19 18853604 missense probably damaging 1.00
R5726:Trpm6 UTSW 19 18853617 missense probably damaging 1.00
R5832:Trpm6 UTSW 19 18786819 missense possibly damaging 0.66
R5843:Trpm6 UTSW 19 18856175 missense probably benign 0.04
R5955:Trpm6 UTSW 19 18892019 missense possibly damaging 0.75
R6101:Trpm6 UTSW 19 18853748 nonsense probably null
R6105:Trpm6 UTSW 19 18853748 nonsense probably null
R6211:Trpm6 UTSW 19 18783128 missense probably damaging 1.00
R6228:Trpm6 UTSW 19 18854291 missense probably damaging 1.00
R6263:Trpm6 UTSW 19 18854108 missense possibly damaging 0.94
R6453:Trpm6 UTSW 19 18829990 missense probably damaging 1.00
R6562:Trpm6 UTSW 19 18838042 missense probably damaging 1.00
R6624:Trpm6 UTSW 19 18796439 critical splice acceptor site probably null
R6624:Trpm6 UTSW 19 18889020 missense probably damaging 1.00
R6729:Trpm6 UTSW 19 18830297 missense probably damaging 1.00
R6765:Trpm6 UTSW 19 18877765 missense probably damaging 1.00
R6976:Trpm6 UTSW 19 18783163 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACGGAATATACAGTTTCCAATCAC -3'
(R):5'- AGCAAGGATCAACTAGAGTAGAGTTCC -3'

Sequencing Primer
(F):5'- GAAAATGAAACTTGGTGAAATTTGC -3'
(R):5'- CTAGAGTAGAGTTCCCAAGGATTTC -3'
Posted On2014-06-23