Incidental Mutation 'R1842:Kdm5d'
ID205863
Institutional Source Beutler Lab
Gene Symbol Kdm5d
Ensembl Gene ENSMUSG00000056673
Gene Namelysine (K)-specific demethylase 5D
SynonymsJarid1d, Smcy, HY
MMRRC Submission 039867-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1842 (G1)
Quality Score222
Status Not validated
ChromosomeY
Chromosomal Location897788-956786 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 927798 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 716 (S716L)
Ref Sequence ENSEMBL: ENSMUSP00000061095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055032] [ENSMUST00000186696] [ENSMUST00000186726]
Predicted Effect probably damaging
Transcript: ENSMUST00000055032
AA Change: S716L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061095
Gene: ENSMUSG00000056673
AA Change: S716L

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
Pfam:zf-C5HC2 706 758 5.2e-18 PFAM
Pfam:PLU-1 771 1096 1.4e-89 PFAM
low complexity region 1147 1156 N/A INTRINSIC
low complexity region 1164 1181 N/A INTRINSIC
PHD 1182 1243 2.54e-6 SMART
coiled coil region 1290 1318 N/A INTRINSIC
low complexity region 1340 1351 N/A INTRINSIC
low complexity region 1395 1406 N/A INTRINSIC
low complexity region 1453 1459 N/A INTRINSIC
low complexity region 1525 1541 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186696
SMART Domains Protein: ENSMUSP00000140663
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 3.45e-23 SMART
ARID 76 165 4.84e-36 SMART
BRIGHT 80 170 4.48e-38 SMART
PHD 325 371 8.56e-13 SMART
JmjC 467 633 2.52e-63 SMART
low complexity region 675 689 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186726
SMART Domains Protein: ENSMUSP00000140462
Gene: ENSMUSG00000056673

DomainStartEndE-ValueType
JmjN 13 54 1.4e-25 SMART
ARID 76 165 3.8e-40 SMART
BRIGHT 80 170 2.3e-40 SMART
Blast:ARID 175 260 1e-41 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187296
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing zinc finger domains. A short peptide derived from this protein is a minor histocompatibility antigen which can lead to graft rejection of male donor cells in a female recipient. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2009]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,506 Y82C probably damaging Het
Abca6 G T 11: 110,197,039 N1087K probably benign Het
Abcc3 G A 11: 94,359,612 T921I probably benign Het
Abr T A 11: 76,508,986 I4F probably damaging Het
Adcy10 T A 1: 165,503,243 V25D probably damaging Het
Ahnak T A 19: 9,005,867 M1505K probably damaging Het
Alms1-ps2 T C 6: 85,796,249 noncoding transcript Het
Apob C G 12: 8,011,559 T3347S probably damaging Het
Arhgap27 C A 11: 103,339,996 G11W probably damaging Het
Armc4 A T 18: 7,223,551 D497E probably benign Het
Ccdc110 A T 8: 45,940,568 I106F probably damaging Het
Ccdc28b T A 4: 129,621,013 D101V probably damaging Het
Ccdc30 T C 4: 119,331,127 E566G probably benign Het
Cenpm T C 15: 82,239,364 S111G probably benign Het
Cep55 A G 19: 38,057,900 I34V probably benign Het
Dcdc2a T C 13: 25,107,602 L190S probably damaging Het
Dhh T C 15: 98,894,560 probably null Het
Dst A G 1: 34,164,119 N703S probably null Het
E030025P04Rik G A 11: 109,139,570 L164F unknown Het
Efcab5 A G 11: 77,134,875 V538A probably benign Het
Egflam A G 15: 7,303,941 S177P probably benign Het
Ehbp1l1 A T 19: 5,725,930 C31S probably damaging Het
Eif2d C A 1: 131,171,060 Q532K probably damaging Het
Elf3 T C 1: 135,256,793 D175G possibly damaging Het
F5 T C 1: 164,184,560 V449A probably damaging Het
Fam110a A T 2: 151,970,034 I272N probably damaging Het
Fbxo34 A G 14: 47,531,007 D608G probably damaging Het
Flrt2 T C 12: 95,779,284 L132P probably damaging Het
Frg2f1 A T 4: 119,531,080 V74D possibly damaging Het
Gad1 G T 2: 70,574,253 E162D probably benign Het
Glb1l A G 1: 75,200,460 V444A probably damaging Het
Gm10770 G A 2: 150,179,156 T147I probably damaging Het
Gm43302 T C 5: 105,277,736 I276V probably benign Het
Greb1 T C 12: 16,696,243 H1314R probably damaging Het
Hapln2 A G 3: 88,024,001 V69A probably damaging Het
Hcn1 T C 13: 117,976,008 I836T probably damaging Het
Hspa5 A G 2: 34,775,803 D553G probably damaging Het
Iqgap1 A T 7: 80,760,883 I194N probably damaging Het
Kansl3 A G 1: 36,351,744 V304A probably damaging Het
Klra6 T C 6: 130,022,610 T132A probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrp1 A G 10: 127,573,468 I1594T possibly damaging Het
Lrp2bp A G 8: 46,011,115 D15G probably benign Het
Map4k1 T C 7: 28,987,163 L170P probably damaging Het
Mast3 A G 8: 70,780,393 F1108L possibly damaging Het
Mettl5 G T 2: 69,885,342 L6I unknown Het
Mfsd14a A T 3: 116,632,408 F447I possibly damaging Het
Mrc2 A G 11: 105,337,720 I642V probably damaging Het
Necap1 A G 6: 122,874,588 Y7C probably damaging Het
Nsd1 G A 13: 55,246,445 E723K probably damaging Het
Nsun3 A T 16: 62,776,392 L121H probably damaging Het
Nsun6 A T 2: 15,009,477 M284K probably damaging Het
Nutf2 T C 8: 105,876,610 probably null Het
Olfr1166 A T 2: 88,124,127 M286K probably damaging Het
Olfr352 A T 2: 36,869,589 N8Y probably damaging Het
Pacs1 T C 19: 5,155,884 E288G probably damaging Het
Peg10 A T 6: 4,756,381 probably benign Het
Rab38 G A 7: 88,450,522 E82K possibly damaging Het
Rgsl1 T A 1: 153,799,797 E206V probably damaging Het
Scube3 G A 17: 28,165,089 V521I probably damaging Het
Sgpp1 C T 12: 75,716,208 V400M probably damaging Het
Slc18b1 T C 10: 23,805,993 S152P possibly damaging Het
Slit1 A T 19: 41,721,038 probably null Het
Spta1 A G 1: 174,195,947 K640R probably benign Het
Svil A G 18: 5,062,373 T898A probably damaging Het
Tex45 T A 8: 3,483,668 F295L possibly damaging Het
Timm44 A G 8: 4,260,510 probably null Het
Tomm40 A G 7: 19,713,725 S127P probably benign Het
Vmn2r23 T A 6: 123,729,690 V493D possibly damaging Het
Yeats2 T C 16: 20,171,238 V288A probably damaging Het
Zfhx4 C T 3: 5,401,498 R2239W probably damaging Het
Zscan2 A C 7: 80,875,553 K341Q probably damaging Het
Other mutations in Kdm5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0013:Kdm5d UTSW Y 941715 missense probably benign 0.37
R0426:Kdm5d UTSW Y 942437 splice site probably benign
R0486:Kdm5d UTSW Y 927107 missense probably damaging 1.00
R0620:Kdm5d UTSW Y 927330 missense probably damaging 0.98
R0781:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1015:Kdm5d UTSW Y 941687 missense possibly damaging 0.95
R1110:Kdm5d UTSW Y 910539 missense probably damaging 1.00
R1163:Kdm5d UTSW Y 898029 missense probably benign 0.18
R1203:Kdm5d UTSW Y 941011 missense probably damaging 1.00
R1238:Kdm5d UTSW Y 941282 missense probably damaging 1.00
R1723:Kdm5d UTSW Y 927753 missense probably damaging 1.00
R1885:Kdm5d UTSW Y 940781 splice site probably null
R2131:Kdm5d UTSW Y 941483 missense probably benign 0.02
R2571:Kdm5d UTSW Y 940932 missense probably benign 0.11
R2931:Kdm5d UTSW Y 942992 missense probably benign 0.18
R3123:Kdm5d UTSW Y 900558 missense possibly damaging 0.63
R3919:Kdm5d UTSW Y 939914 missense probably damaging 1.00
R4018:Kdm5d UTSW Y 910441 splice site probably benign
R4031:Kdm5d UTSW Y 916910 missense probably damaging 1.00
R4403:Kdm5d UTSW Y 899830 missense probably damaging 1.00
R4571:Kdm5d UTSW Y 927110 missense probably damaging 1.00
R4583:Kdm5d UTSW Y 914134 missense probably damaging 1.00
R4962:Kdm5d UTSW Y 940624 missense probably damaging 1.00
R5105:Kdm5d UTSW Y 941752 missense probably benign 0.00
R5249:Kdm5d UTSW Y 916692 missense probably damaging 1.00
R5367:Kdm5d UTSW Y 941645 missense probably benign 0.05
R5373:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5374:Kdm5d UTSW Y 927995 missense probably benign 0.09
R5876:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R5909:Kdm5d UTSW Y 941306 missense probably benign 0.01
R6014:Kdm5d UTSW Y 921528 missense probably benign 0.45
R6109:Kdm5d UTSW Y 921501 missense probably damaging 1.00
R6251:Kdm5d UTSW Y 921693 missense probably damaging 1.00
R6349:Kdm5d UTSW Y 916847 missense probably damaging 0.99
R6450:Kdm5d UTSW Y 927056 missense probably damaging 1.00
R6595:Kdm5d UTSW Y 939829 missense probably benign
R6628:Kdm5d UTSW Y 900525 missense probably damaging 1.00
R6745:Kdm5d UTSW Y 927112 missense probably benign 0.28
R6867:Kdm5d UTSW Y 927425 missense probably benign
R6963:Kdm5d UTSW Y 937975 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGCTATCCTTACAAGCTTAAGCC -3'
(R):5'- AGCAGGCAGTTCATCCAATG -3'

Sequencing Primer
(F):5'- CCACAGCAGGGCTCAGTATTG -3'
(R):5'- CCAATGTGTACCTGTACCTAGAGG -3'
Posted On2014-06-23