Incidental Mutation 'R1855:Pogz'
ID206010
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Namepogo transposable element with ZNF domain
Synonyms9530006B08Rik
MMRRC Submission 039879-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.809) question?
Stock #R1855 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location94837567-94882326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94878849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 863 (T863I)
Ref Sequence ENSEMBL: ENSMUSP00000102887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
Predicted Effect probably benign
Transcript: ENSMUST00000042402
AA Change: T907I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: T907I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107266
AA Change: T863I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: T863I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107269
AA Change: T821I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: T821I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107270
AA Change: T916I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: T916I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142253
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.4%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik T A 1: 11,747,971 L285Q probably damaging Het
Acaca T C 11: 84,371,554 L1994P probably damaging Het
Adamts9 A G 6: 92,901,369 probably benign Het
Aff3 T C 1: 38,210,304 E574G probably benign Het
Ankrd1 T C 19: 36,119,235 K64R probably damaging Het
Arhgap23 T C 11: 97,448,697 I163T probably damaging Het
Ascc3 A T 10: 50,617,922 Q151L probably benign Het
Atad2 G A 15: 58,097,289 P971L possibly damaging Het
C1s1 A C 6: 124,534,356 probably null Het
Ccdc150 T C 1: 54,367,910 probably benign Het
Cdhr3 A T 12: 33,060,352 I311N probably damaging Het
Chad T A 11: 94,565,477 L127H probably damaging Het
Clasp1 G A 1: 118,508,894 A303T probably damaging Het
Clptm1 A G 7: 19,638,209 V234A probably benign Het
Cnih3 C A 1: 181,454,621 S140* probably null Het
Col24a1 G A 3: 145,459,140 G1033D probably damaging Het
Csnk1a1 T A 18: 61,575,427 probably null Het
Cttnbp2 T A 6: 18,378,413 I1475L probably benign Het
Dnah5 T C 15: 28,411,669 V3728A possibly damaging Het
Dock9 C A 14: 121,640,159 V391F probably damaging Het
Ehmt2 A T 17: 34,910,776 I949F probably damaging Het
Eif4g1 C A 16: 20,687,161 T1025K possibly damaging Het
Enpp2 C T 15: 54,845,823 E803K probably damaging Het
Esrrg A T 1: 188,211,098 M423L probably damaging Het
Etnppl A T 3: 130,620,722 I89F probably benign Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam122b T A X: 53,254,056 Q201H probably benign Het
Fbln7 A G 2: 128,893,835 T248A possibly damaging Het
Galnt9 C T 5: 110,615,524 T465M probably damaging Het
Grcc10 A G 6: 124,740,578 V57A probably benign Het
Herc1 T A 9: 66,391,426 M614K possibly damaging Het
Itch C T 2: 155,172,454 probably benign Het
Kdm6b C A 11: 69,407,286 A167S probably damaging Het
Kidins220 C T 12: 25,056,591 R1348C probably damaging Het
Kif17 T C 4: 138,288,271 L577P probably benign Het
Krt25 A T 11: 99,318,315 L258Q probably damaging Het
March10 T C 11: 105,390,392 T356A probably benign Het
Mical2 G A 7: 112,345,282 A940T probably benign Het
Mrpl4 A G 9: 21,003,371 E81G possibly damaging Het
Mtcl1 A G 17: 66,379,514 V447A probably benign Het
Mtor C A 4: 148,553,089 N2502K probably benign Het
Notch4 G A 17: 34,580,962 D966N probably benign Het
Oip5 C A 2: 119,611,790 K214N probably benign Het
Olfr160 A T 9: 37,711,970 F103Y possibly damaging Het
Pak7 A T 2: 136,087,509 S585T probably benign Het
Pard3 T A 8: 127,447,812 probably null Het
Pcnx2 A T 8: 125,807,996 probably benign Het
Pcsk5 T C 19: 17,515,192 Y939C possibly damaging Het
Pde1a A G 2: 79,898,064 probably null Het
Pde9a C T 17: 31,455,120 P60S probably damaging Het
Pikfyve C A 1: 65,258,798 T1562K probably benign Het
Plekhg6 A T 6: 125,375,839 M115K probably damaging Het
Ppp1r3a A T 6: 14,754,994 W85R probably damaging Het
Rnf123 C A 9: 108,061,791 R826L probably damaging Het
Slc1a6 T A 10: 78,812,924 V493E probably damaging Het
Slc22a2 A G 17: 12,586,812 D150G probably damaging Het
Snap47 C T 11: 59,428,333 probably benign Het
Spata22 A G 11: 73,340,559 D213G probably benign Het
St6galnac2 T A 11: 116,690,315 R60S probably benign Het
Stk32c A G 7: 139,121,447 F263S probably damaging Het
Supt6 T C 11: 78,232,540 I104V possibly damaging Het
Tex2 T C 11: 106,546,876 E158G possibly damaging Het
Tiam2 C T 17: 3,415,135 R380C probably damaging Het
Trim25 C T 11: 89,015,581 T410I probably benign Het
Usp18 T A 6: 121,262,117 C212S probably benign Het
Vmn1r2 A G 4: 3,172,588 Y169C probably damaging Het
Wdr33 A T 18: 31,906,856 probably benign Het
Xpr1 A G 1: 155,283,256 Y597H probably benign Het
Yy1 CGGG CGGGGGGGGG 12: 108,793,990 probably benign Het
Zfp54 T A 17: 21,434,142 Y299* probably null Het
Zfp566 T G 7: 30,078,502 S85R probably benign Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
FR4976:Pogz UTSW 3 94874695 unclassified probably benign
PIT4382001:Pogz UTSW 3 94879796 missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94872370 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1670:Pogz UTSW 3 94878849 missense probably benign 0.21
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R6104:Pogz UTSW 3 94880031 missense probably benign 0.09
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGTTCGACTGGAGCATG -3'
(R):5'- TTTCGAAAGTGTTCAGCCGC -3'

Sequencing Primer
(F):5'- GGAGCATGAAGAATACATATCTTCC -3'
(R):5'- CCTGTTCAGTGTTGCAGCACAG -3'
Posted On2014-06-23