Incidental Mutation 'R1856:Slc12a6'
ID206085
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.177) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to T at 112335927 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106619 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect probably null
Transcript: ENSMUST00000028549
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053666
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110987
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110991
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141047
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttk A T 9: 83,869,263 I798F probably damaging Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4412:Slc12a6 UTSW 2 112335888 missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112356627 intron probably benign
R5372:Slc12a6 UTSW 2 112347360 nonsense probably null
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112337358 missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112334415 missense probably benign 0.04
R7395:Slc12a6 UTSW 2 112352542 missense probably damaging 1.00
R7552:Slc12a6 UTSW 2 112341974 missense not run
Predicted Primers PCR Primer
(F):5'- AGCATCTTTTATGGCTATGGCTAAC -3'
(R):5'- GCCCTACCAACTTTATTTTCAGGAC -3'

Sequencing Primer
(F):5'- GGCTATGGCTAACTATATAATTTCCC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On2014-06-23