Incidental Mutation 'R0113:C4b'
ID20610
Institutional Source Beutler Lab
Gene Symbol C4b
Ensembl Gene ENSMUSG00000073418
Gene Namecomplement component 4B (Chido blood group)
SynonymsC4, Ss
MMRRC Submission 038399-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0113 (G1)
Quality Score114
Status Validated (trace)
Chromosome17
Chromosomal Location34728380-34743882 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34741240 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 279 (Y279F)
Ref Sequence ENSEMBL: ENSMUSP00000069418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069507]
Predicted Effect probably damaging
Transcript: ENSMUST00000069507
AA Change: Y279F

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069418
Gene: ENSMUSG00000073418
AA Change: Y279F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:A2M_N 138 231 2e-19 PFAM
A2M_N_2 470 609 2.87e-26 SMART
ANATO 700 734 3.58e-12 SMART
low complexity region 761 771 N/A INTRINSIC
A2M 779 867 1.46e-27 SMART
Pfam:Thiol-ester_cl 995 1024 7.7e-13 PFAM
Pfam:A2M_comp 1047 1313 1.3e-82 PFAM
low complexity region 1441 1447 N/A INTRINSIC
A2M_recep 1475 1564 1.03e-36 SMART
C345C 1608 1720 5.69e-40 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174597
Meta Mutation Damage Score 0.074 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.1%
  • 10x: 95.2%
  • 20x: 87.5%
Validation Efficiency 99% (70/71)
MGI Phenotype PHENOTYPE: Homozygous C4 deficient mice have compromised immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik A G 8: 10,926,126 noncoding transcript Het
4930432K21Rik C T 8: 84,167,242 T311I probably damaging Het
Abca13 A T 11: 9,292,114 I1326F possibly damaging Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Aspscr1 C G 11: 120,688,925 Q97E probably damaging Het
Atad2 A G 15: 58,120,934 probably benign Het
Atcay A T 10: 81,214,720 probably null Het
Cav1 A T 6: 17,308,049 S67C possibly damaging Het
Celf2 A C 2: 6,624,714 H113Q probably damaging Het
Cep170 A C 1: 176,758,455 N590K probably damaging Het
Ces1f A T 8: 93,279,699 M1K probably null Het
Chrna1 C A 2: 73,566,836 D370Y possibly damaging Het
Csmd1 C A 8: 15,984,849 G2441C probably damaging Het
D630003M21Rik C T 2: 158,196,575 D984N possibly damaging Het
Dhrs1 T C 14: 55,739,939 T241A probably benign Het
Edar A C 10: 58,629,449 C31G probably damaging Het
Eps8 A G 6: 137,537,684 S24P possibly damaging Het
Fam149a T C 8: 45,341,024 E669G probably damaging Het
Fcrla A T 1: 170,922,299 M1K probably null Het
G3bp1 T A 11: 55,495,426 V237E probably benign Het
Galnt5 A G 2: 57,998,877 E163G probably benign Het
Gm5155 G A 7: 17,908,948 noncoding transcript Het
Gpr87 T C 3: 59,179,511 D192G possibly damaging Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Ints1 T C 5: 139,765,213 T810A probably benign Het
Kalrn A G 16: 34,049,936 probably benign Het
Kcnk6 T C 7: 29,232,209 D92G probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mfsd6 A T 1: 52,709,189 N172K probably damaging Het
Mtcl1 G T 17: 66,354,242 Q1225K possibly damaging Het
Nav2 C T 7: 49,535,953 T948M probably damaging Het
Nfic T C 10: 81,420,585 K104E probably damaging Het
Nupl1 G A 14: 60,251,291 probably benign Het
Nwd2 A T 5: 63,807,898 K1608N probably damaging Het
Olfr148 T A 9: 39,614,002 I145K probably benign Het
Olfr50 G A 2: 36,793,994 G253R probably damaging Het
Olfr50 G T 2: 36,793,995 G253V probably damaging Het
Phf21b T C 15: 84,804,767 D186G probably damaging Het
Poli C T 18: 70,528,758 C57Y probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Psg23 T C 7: 18,612,002 Y256C probably benign Het
Satb1 C A 17: 51,782,698 E374* probably null Het
Scn4a C T 11: 106,345,436 E333K probably benign Het
Sec14l2 C T 11: 4,103,661 probably benign Het
Slain1 T C 14: 103,685,825 probably benign Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Syne2 T C 12: 75,930,578 S1266P probably damaging Het
Syne2 A G 12: 76,033,722 E4810G probably damaging Het
Tbck T C 3: 132,743,080 I618T probably damaging Het
Tmem132d A T 5: 127,784,593 N821K probably benign Het
Trim28 T A 7: 13,028,701 V381E probably damaging Het
Ttc1 T C 11: 43,745,288 S43G probably benign Het
Ube2u A G 4: 100,481,655 E39G possibly damaging Het
Urb2 T C 8: 124,030,926 V1124A probably benign Het
Usp13 A G 3: 32,817,876 probably benign Het
Vmn1r216 A T 13: 23,099,461 S105C probably damaging Het
Yipf2 T C 9: 21,590,116 T23A probably damaging Het
Zfp521 G A 18: 13,845,091 T755M probably damaging Het
Zfp619 T A 7: 39,537,759 M1071K probably benign Het
Zfp942 A T 17: 21,929,085 C188S probably benign Het
Other mutations in C4b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:C4b APN 17 34734428 missense probably damaging 1.00
IGL00433:C4b APN 17 34742041 missense possibly damaging 0.75
IGL00471:C4b APN 17 34734429 missense probably damaging 1.00
IGL00515:C4b APN 17 34728891 missense probably damaging 1.00
IGL01599:C4b APN 17 34743019 splice site probably benign
IGL01761:C4b APN 17 34739938 missense possibly damaging 0.56
IGL02004:C4b APN 17 34739010 unclassified probably benign
IGL02215:C4b APN 17 34734491 missense probably damaging 1.00
IGL02517:C4b APN 17 34734408 missense probably benign 0.01
IGL02926:C4b APN 17 34730712 missense possibly damaging 0.95
IGL03031:C4b APN 17 34731130 missense possibly damaging 0.47
IGL03057:C4b APN 17 34737764 unclassified probably benign
IGL03165:C4b APN 17 34739955 missense probably benign 0.13
IGL03380:C4b APN 17 34740286 missense probably benign 0.01
FR4548:C4b UTSW 17 34740997 missense probably benign 0.00
PIT4142001:C4b UTSW 17 34733701 missense probably benign 0.01
R0064:C4b UTSW 17 34738856 missense probably damaging 1.00
R0143:C4b UTSW 17 34734219 unclassified probably benign
R0254:C4b UTSW 17 34734776 missense probably benign 0.00
R0320:C4b UTSW 17 34733161 missense probably benign 0.01
R0391:C4b UTSW 17 34735614 splice site probably benign
R0399:C4b UTSW 17 34728869 missense probably damaging 1.00
R0467:C4b UTSW 17 34736127 missense probably benign 0.01
R0549:C4b UTSW 17 34735415 missense probably damaging 1.00
R0561:C4b UTSW 17 34734417 missense probably damaging 0.99
R0662:C4b UTSW 17 34730888 missense probably damaging 1.00
R0941:C4b UTSW 17 34740055 missense probably benign
R1161:C4b UTSW 17 34729593 missense probably damaging 1.00
R1169:C4b UTSW 17 34742972 missense probably benign 0.14
R1186:C4b UTSW 17 34736309 missense possibly damaging 0.47
R1310:C4b UTSW 17 34729593 missense probably damaging 1.00
R1398:C4b UTSW 17 34730719 unclassified probably benign
R1472:C4b UTSW 17 34743769 nonsense probably null
R1496:C4b UTSW 17 34740021 missense probably benign 0.30
R1544:C4b UTSW 17 34738967 missense probably benign 0.13
R1588:C4b UTSW 17 34741025 missense probably benign
R1645:C4b UTSW 17 34740597 missense probably damaging 1.00
R1664:C4b UTSW 17 34732978 missense probably damaging 1.00
R1678:C4b UTSW 17 34743650 missense probably benign 0.05
R1710:C4b UTSW 17 34743664 splice site probably benign
R1713:C4b UTSW 17 34729271 splice site probably benign
R1770:C4b UTSW 17 34736927 missense possibly damaging 0.78
R1859:C4b UTSW 17 34735553 missense probably benign
R1924:C4b UTSW 17 34729657 missense probably damaging 1.00
R2057:C4b UTSW 17 34728620 missense probably damaging 1.00
R2060:C4b UTSW 17 34736101 missense probably damaging 1.00
R2184:C4b UTSW 17 34737702 missense probably benign 0.27
R2306:C4b UTSW 17 34728518 missense probably benign 0.00
R2363:C4b UTSW 17 34736058 splice site probably benign
R2365:C4b UTSW 17 34736058 splice site probably benign
R2379:C4b UTSW 17 34735743 missense possibly damaging 0.81
R2860:C4b UTSW 17 34734758 missense probably damaging 0.99
R2861:C4b UTSW 17 34734758 missense probably damaging 0.99
R3551:C4b UTSW 17 34741872 missense possibly damaging 0.75
R3765:C4b UTSW 17 34729840 missense probably damaging 0.98
R4157:C4b UTSW 17 34742855 missense probably damaging 1.00
R4299:C4b UTSW 17 34731144 missense possibly damaging 0.52
R4365:C4b UTSW 17 34734743 missense possibly damaging 0.65
R4411:C4b UTSW 17 34728864 missense probably damaging 1.00
R4613:C4b UTSW 17 34734551 missense probably benign 0.12
R4784:C4b UTSW 17 34733406 missense probably benign 0.00
R4790:C4b UTSW 17 34734143 missense probably benign 0.01
R4831:C4b UTSW 17 34736890 splice site probably null
R4879:C4b UTSW 17 34743647 missense probably damaging 0.99
R5036:C4b UTSW 17 34740445 critical splice acceptor site probably null
R5361:C4b UTSW 17 34741238 missense probably benign 0.15
R5384:C4b UTSW 17 34737661 missense possibly damaging 0.89
R5518:C4b UTSW 17 34734442 missense probably benign 0.00
R5590:C4b UTSW 17 34740335 missense probably damaging 0.98
R5643:C4b UTSW 17 34742417 missense probably benign 0.01
R5644:C4b UTSW 17 34742417 missense probably benign 0.01
R5833:C4b UTSW 17 34730673 missense probably damaging 1.00
R5931:C4b UTSW 17 34729193 missense probably damaging 0.99
R6178:C4b UTSW 17 34733406 missense probably benign 0.00
R6209:C4b UTSW 17 34741087 missense possibly damaging 0.93
R6225:C4b UTSW 17 34738874 missense possibly damaging 0.64
R6518:C4b UTSW 17 34734205 missense probably damaging 0.98
R6613:C4b UTSW 17 34733565 missense probably damaging 0.99
R6781:C4b UTSW 17 34742954 missense probably damaging 0.99
R6807:C4b UTSW 17 34730956 missense probably benign 0.17
R6858:C4b UTSW 17 34729831 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGAACTGGTCCTTTGAGATG -3'
(R):5'- TGCCCAGCAACAGTGATGAAATCC -3'

Sequencing Primer
(F):5'- AACTGGTCCTTTGAGATGGAAATG -3'
(R):5'- ccctcagaacccccacc -3'
Posted On2013-04-11