Incidental Mutation 'R1856:Ttk'
ID206134
Institutional Source Beutler Lab
Gene Symbol Ttk
Ensembl Gene ENSMUSG00000038379
Gene NameTtk protein kinase
SynonymsMps1, Esk1
MMRRC Submission 039880-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R1856 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location83834689-83872389 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 83869263 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 798 (I798F)
Ref Sequence ENSEMBL: ENSMUSP00000064839 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070326] [ENSMUST00000185913]
Predicted Effect probably damaging
Transcript: ENSMUST00000070326
AA Change: I798F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000064839
Gene: ENSMUSG00000038379
AA Change: I798F

DomainStartEndE-ValueType
PDB:4B94|D 55 235 7e-97 PDB
low complexity region 459 487 N/A INTRINSIC
S_TKc 498 764 1.14e-77 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000185913
AA Change: I741F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139956
Gene: ENSMUSG00000038379
AA Change: I741F

DomainStartEndE-ValueType
PDB:4B94|D 55 235 2e-97 PDB
low complexity region 459 487 N/A INTRINSIC
Pfam:Pkinase 498 661 7.9e-36 PFAM
Pfam:Pkinase_Tyr 498 661 6.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188445
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual specificity protein kinase with the ability to phosphorylate tyrosine, serine and threonine. Associated with cell proliferation, this protein is essential for chromosome alignment at the centromere during mitosis and is required for centrosome duplication. It has been found to be a critical mitotic checkpoint protein for accurate segregation of chromosomes during mitosis. Tumorigenesis may occur when this protein fails to degrade and produces excess centrosomes resulting in aberrant mitotic spindles. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a floxed allele activated in oocytes exhibit reduced female fertility associated with defective spindle assembly checkpoint, premature chromosome segregation, and accelerated anaphase and polar body extrusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 113 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 T G 7: 120,278,181 F1017L probably damaging Het
Abcb11 A C 2: 69,245,923 V1147G probably damaging Het
Abcc10 T A 17: 46,306,603 S1128C probably damaging Het
Adam6a G A 12: 113,545,303 C432Y probably damaging Het
Adamdec1 C T 14: 68,570,948 V318M probably damaging Het
Ahnak C A 19: 9,002,048 S232Y possibly damaging Het
Amt A C 9: 108,297,162 H42P probably damaging Het
Anapc1 A T 2: 128,659,788 L778Q probably damaging Het
Ankhd1 G A 18: 36,644,527 A1588T probably benign Het
Anln A T 9: 22,353,331 L881Q probably damaging Het
Appl1 A G 14: 26,927,749 S607P probably damaging Het
Arg2 G T 12: 79,147,662 V87L probably benign Het
Atp13a2 C T 4: 141,004,012 P869L probably benign Het
Atxn7l1 T A 12: 33,358,770 D310E probably damaging Het
Cd6 A T 19: 10,798,602 D164E probably damaging Het
Cdan1 C A 2: 120,724,936 V775L probably benign Het
Cep164 A T 9: 45,775,758 probably null Het
Cep41 A G 6: 30,661,006 S61P probably damaging Het
Clcn7 C A 17: 25,160,471 D764E probably damaging Het
Cog2 G A 8: 124,551,403 G703S possibly damaging Het
Cramp1l T C 17: 24,968,978 D1214G probably damaging Het
Cst7 G T 2: 150,577,708 C98F probably damaging Het
Ctc1 T A 11: 69,034,658 L1007Q probably damaging Het
Cyb5r4 G A 9: 87,022,209 A11T possibly damaging Het
Dcaf8 A G 1: 172,175,553 D306G probably damaging Het
Defb38 T A 8: 19,023,576 K27I probably benign Het
Disp3 T C 4: 148,271,632 E257G probably damaging Het
Dnajc6 T C 4: 101,598,988 S58P probably damaging Het
Dock10 A T 1: 80,606,568 D140E possibly damaging Het
Dopey1 T C 9: 86,492,004 V172A probably damaging Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Eci3 C T 13: 34,953,028 A171T possibly damaging Het
Eml2 A G 7: 19,194,061 D284G probably damaging Het
Eml5 T C 12: 98,810,584 D1377G probably damaging Het
Fam186a T C 15: 99,940,302 E2687G possibly damaging Het
Fut9 A C 4: 25,620,352 L154R probably damaging Het
Gabrb2 A G 11: 42,626,713 N454S probably benign Het
Gm438 T A 4: 144,777,883 M233L probably benign Het
Gpr183 T A 14: 121,954,741 I123L probably benign Het
Gucy1b1 A T 3: 82,058,352 N62K probably benign Het
Hcrtr2 T C 9: 76,259,785 N90S probably damaging Het
Hectd1 A T 12: 51,744,794 L2556Q probably damaging Het
Hfm1 T A 5: 106,847,676 M1290L probably benign Het
Hgsnat A G 8: 25,957,256 W337R probably benign Het
Hmbox1 T C 14: 64,828,648 Y291C probably damaging Het
Hmcn1 T C 1: 150,721,664 N1749S probably benign Het
Igsf10 T C 3: 59,331,272 D496G possibly damaging Het
Iqch C T 9: 63,534,337 probably null Het
Irf6 A G 1: 193,167,535 D255G probably benign Het
Kif9 G A 9: 110,517,719 G642R probably null Het
Klhl20 A G 1: 161,106,742 Y236H probably benign Het
Krt39 T A 11: 99,519,088 K208* probably null Het
Lama3 T A 18: 12,537,781 L808* probably null Het
Lrp5 C T 19: 3,597,346 A1299T probably benign Het
Lysmd4 A G 7: 67,226,231 Q214R probably benign Het
Macf1 T A 4: 123,369,848 E6960V probably damaging Het
Mcpt2 A G 14: 56,043,699 E120G probably benign Het
Mpeg1 A G 19: 12,462,356 T393A probably benign Het
Myh4 G A 11: 67,255,682 E1494K probably damaging Het
Nbas T G 12: 13,474,229 S1695R possibly damaging Het
Nlgn1 G T 3: 25,440,037 Y249* probably null Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Nup107 A G 10: 117,750,906 L910P probably damaging Het
Obscn T A 11: 59,040,296 D5838V probably damaging Het
Olfr1218 G A 2: 89,054,859 T189M possibly damaging Het
Olfr347 T C 2: 36,734,345 I8T probably benign Het
Olfr926 T C 9: 38,877,596 I140T possibly damaging Het
Olfr978 T C 9: 39,994,359 I183T probably benign Het
Otogl G T 10: 107,854,264 S915Y possibly damaging Het
P2rx7 T A 5: 122,681,032 C506S probably damaging Het
P4hb T C 11: 120,563,218 E350G probably benign Het
Papolg A T 11: 23,867,379 V606E probably benign Het
Pappa A T 4: 65,340,743 D1576V probably damaging Het
Pclo G T 5: 14,778,552 V1402F probably damaging Het
Pdcd11 A G 19: 47,098,187 T211A probably benign Het
Pdzd2 T C 15: 12,373,855 R2065G possibly damaging Het
Plcl2 T C 17: 50,607,850 V629A probably benign Het
Prkcsh G A 9: 22,004,575 V92I possibly damaging Het
Prpf19 G T 19: 10,902,416 V320F probably damaging Het
Ptpn3 T A 4: 57,239,682 I283F probably damaging Het
Rcc2 T A 4: 140,720,604 D480E probably benign Het
Rnf182 G A 13: 43,668,042 C23Y probably damaging Het
Rnf186 C T 4: 138,967,362 T71I probably benign Het
Scyl3 A G 1: 163,933,696 probably null Het
Slc12a6 G T 2: 112,335,927 probably null Het
Slc1a2 C A 2: 102,777,567 S520Y probably damaging Het
Slc35e2 T A 4: 155,611,729 L191Q probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Snx33 T C 9: 56,926,011 H258R possibly damaging Het
Tecpr2 A T 12: 110,933,064 H622L probably benign Het
Thbs3 A T 3: 89,226,406 E888D probably damaging Het
Tlk2 T C 11: 105,221,298 L159P probably benign Het
Tmem70 A T 1: 16,677,273 T205S probably damaging Het
Trappc10 T A 10: 78,196,451 H1001L probably benign Het
Trim12a T C 7: 104,300,857 T292A probably benign Het
Trip11 G A 12: 101,883,333 R92* probably null Het
Trpa1 G A 1: 14,899,388 Q386* probably null Het
Trpc4 T A 3: 54,279,989 V454D probably damaging Het
Ttc36 A T 9: 44,802,754 D22E probably benign Het
Ttn T C 2: 76,743,633 I17312V probably damaging Het
Txndc15 A T 13: 55,718,062 E113V possibly damaging Het
Ube2d4 T A 15: 58,846,599 noncoding transcript Het
Urb1 T A 16: 90,761,695 T1723S probably benign Het
Vmn1r65 A T 7: 6,008,266 V323D possibly damaging Het
Vmn2r54 A G 7: 12,632,311 M232T probably benign Het
Wdr59 A G 8: 111,476,181 S577P probably damaging Het
Wfikkn2 C T 11: 94,238,123 W397* probably null Het
Ypel1 T A 16: 17,081,647 probably null Het
Ythdf1 T A 2: 180,910,970 D484V probably damaging Het
Zdhhc17 A G 10: 110,947,293 probably null Het
Zfp472 A T 17: 32,965,913 H2L possibly damaging Het
Zfp953 A T 13: 67,345,358 M74K probably benign Het
Zmat4 C T 8: 23,929,135 T61M probably benign Het
Other mutations in Ttk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00721:Ttk APN 9 83863448 missense probably damaging 1.00
IGL01298:Ttk APN 9 83865142 missense probably benign 0.27
IGL02806:Ttk APN 9 83862487 nonsense probably null
IGL03080:Ttk APN 9 83843083 missense probably damaging 1.00
R0396:Ttk UTSW 9 83847260 unclassified probably benign
R0507:Ttk UTSW 9 83868067 missense probably damaging 0.97
R0827:Ttk UTSW 9 83843915 missense probably benign
R1077:Ttk UTSW 9 83844149 unclassified probably benign
R1730:Ttk UTSW 9 83868592 missense possibly damaging 0.86
R1844:Ttk UTSW 9 83854862 missense possibly damaging 0.55
R1941:Ttk UTSW 9 83853126 missense probably benign 0.22
R2191:Ttk UTSW 9 83862183 missense probably damaging 0.99
R3737:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4035:Ttk UTSW 9 83854837 missense possibly damaging 0.88
R4903:Ttk UTSW 9 83865148 missense probably benign 0.42
R4908:Ttk UTSW 9 83843686 missense possibly damaging 0.96
R4966:Ttk UTSW 9 83865148 missense probably benign 0.42
R5023:Ttk UTSW 9 83863541 missense probably damaging 1.00
R5197:Ttk UTSW 9 83839341 missense probably benign
R5567:Ttk UTSW 9 83862535 missense possibly damaging 0.94
R6022:Ttk UTSW 9 83839322 missense probably damaging 1.00
R6900:Ttk UTSW 9 83872030 missense probably damaging 0.96
R7039:Ttk UTSW 9 83868092 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAAGAATGCCAGCTAGTGTAC -3'
(R):5'- TTCCCAAAGGCTGTATTCAGAATTG -3'

Sequencing Primer
(F):5'- GGGCAGAGTCTTACTACTATAGC -3'
(R):5'- GGCTGTATTCAGAATTGACTAGAAG -3'
Posted On2014-06-23