Incidental Mutation 'R1857:Trove2'
ID206194
Institutional Source Beutler Lab
Gene Symbol Trove2
Ensembl Gene ENSMUSG00000018199
Gene NameTROVE domain family, member 2
Synonyms1810007I17Rik, A530054J02Rik, SS-A/Ro, Ssa, Ssa2
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.151) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location143750790-143777068 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 143770750 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 86 (T86A)
Ref Sequence ENSEMBL: ENSMUSP00000125623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159879]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000018343
Predicted Effect probably benign
Transcript: ENSMUST00000159879
AA Change: T86A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125623
Gene: ENSMUSG00000018199
AA Change: T86A

DomainStartEndE-ValueType
Pfam:TROVE 16 369 9.7e-99 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice develop symptoms similar to those observed in patients with lupus, including increased photosensitivity and membranoproliferative glomerulonephritis. The production of autoantibodies is detected in both homozygous and heterozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Trove2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Trove2 APN 1 143761382 missense probably benign 0.29
IGL01578:Trove2 APN 1 143761300 missense probably damaging 0.99
IGL02006:Trove2 APN 1 143760346 splice site probably benign
IGL02155:Trove2 APN 1 143761269 critical splice donor site probably null
IGL02219:Trove2 APN 1 143761275 missense possibly damaging 0.94
IGL02637:Trove2 APN 1 143770788 missense probably damaging 1.00
IGL03013:Trove2 APN 1 143770708 missense probably damaging 1.00
IGL03075:Trove2 APN 1 143770771 missense probably benign
R0415:Trove2 UTSW 1 143760075 missense probably benign 0.00
R0443:Trove2 UTSW 1 143765923 splice site probably benign
R0479:Trove2 UTSW 1 143757751 missense possibly damaging 0.72
R1696:Trove2 UTSW 1 143757837 missense probably damaging 0.99
R1728:Trove2 UTSW 1 143760014 missense probably benign
R1728:Trove2 UTSW 1 143760034 missense probably benign
R1729:Trove2 UTSW 1 143760014 missense probably benign
R1729:Trove2 UTSW 1 143760034 missense probably benign
R1730:Trove2 UTSW 1 143760014 missense probably benign
R1730:Trove2 UTSW 1 143760034 missense probably benign
R1739:Trove2 UTSW 1 143760014 missense probably benign
R1739:Trove2 UTSW 1 143760034 missense probably benign
R1762:Trove2 UTSW 1 143760014 missense probably benign
R1762:Trove2 UTSW 1 143760034 missense probably benign
R1783:Trove2 UTSW 1 143760014 missense probably benign
R1783:Trove2 UTSW 1 143760034 missense probably benign
R1784:Trove2 UTSW 1 143760014 missense probably benign
R1784:Trove2 UTSW 1 143760034 missense probably benign
R1785:Trove2 UTSW 1 143760014 missense probably benign
R1785:Trove2 UTSW 1 143760034 missense probably benign
R2049:Trove2 UTSW 1 143760034 missense probably benign
R2130:Trove2 UTSW 1 143760034 missense probably benign
R2131:Trove2 UTSW 1 143760034 missense probably benign
R2133:Trove2 UTSW 1 143760034 missense probably benign
R2141:Trove2 UTSW 1 143760034 missense probably benign
R2142:Trove2 UTSW 1 143760034 missense probably benign
R2372:Trove2 UTSW 1 143770882 nonsense probably null
R2929:Trove2 UTSW 1 143757878 missense possibly damaging 0.92
R4191:Trove2 UTSW 1 143770786 missense probably benign 0.00
R5520:Trove2 UTSW 1 143770771 missense probably benign
R5821:Trove2 UTSW 1 143766765 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ACATGCCACACTTCATGCTC -3'
(R):5'- TTGCAGCCACTGAGTGAGAC -3'

Sequencing Primer
(F):5'- CTCCTTCAGGTCTTTCTTAAACTGG -3'
(R):5'- TGTATGGCAGGTCACCGACATG -3'
Posted On2014-06-23