Incidental Mutation 'R1857:Cyp2j5'
ID206208
Institutional Source Beutler Lab
Gene Symbol Cyp2j5
Ensembl Gene ENSMUSG00000052520
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 5
Synonyms
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.028) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location96628773-96664154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 96659486 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 173 (E173G)
Ref Sequence ENSEMBL: ENSMUSP00000030299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030299
AA Change: E173G

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030299
Gene: ENSMUSG00000052520
AA Change: E173G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 44 497 2.3e-140 PFAM
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Female mice homozygous for a null mutation display increased systolic blood pressure, increased left ventricular weight, decreased litter sizes, decreased serum estrogen levels, and increased induced vasoconstriction responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Cyp2j5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Cyp2j5 APN 4 96630775 missense probably damaging 1.00
IGL00670:Cyp2j5 APN 4 96634275 missense probably benign 0.05
IGL00824:Cyp2j5 APN 4 96663923 missense probably benign
IGL01450:Cyp2j5 APN 4 96658690 missense probably damaging 0.99
IGL01621:Cyp2j5 APN 4 96629554 missense probably benign
IGL02639:Cyp2j5 APN 4 96658749 missense probably benign 0.12
IGL03024:Cyp2j5 APN 4 96629523 missense probably benign 0.03
IGL03212:Cyp2j5 APN 4 96663818 missense probably damaging 0.97
R0112:Cyp2j5 UTSW 4 96629523 missense probably benign 0.03
R0626:Cyp2j5 UTSW 4 96659512 missense probably benign 0.01
R1387:Cyp2j5 UTSW 4 96634285 missense probably damaging 1.00
R1638:Cyp2j5 UTSW 4 96635815 missense probably benign 0.02
R1920:Cyp2j5 UTSW 4 96663254 missense probably damaging 1.00
R2149:Cyp2j5 UTSW 4 96641340 missense possibly damaging 0.95
R2213:Cyp2j5 UTSW 4 96659615 missense probably benign 0.09
R4028:Cyp2j5 UTSW 4 96641416 nonsense probably null
R4895:Cyp2j5 UTSW 4 96663110 critical splice donor site probably null
R5132:Cyp2j5 UTSW 4 96629496 missense probably damaging 1.00
R5149:Cyp2j5 UTSW 4 96659507 missense probably damaging 1.00
R5666:Cyp2j5 UTSW 4 96658693 missense probably benign 0.00
R6676:Cyp2j5 UTSW 4 96635808 missense possibly damaging 0.57
Predicted Primers PCR Primer
(F):5'- CTAGTCGAGTGCAAAGCCTG -3'
(R):5'- CATGTCTCTAGTATTTGCTGCATG -3'

Sequencing Primer
(F):5'- CATGCAGGCAGTGACTTCTCATAG -3'
(R):5'- AGTCGTATCTAATGGCCAG -3'
Posted On2014-06-23