Incidental Mutation 'R1857:Eif4g3'
ID206214
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission 039881-MU
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138175876 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1169 (Q1169L)
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105831] [ENSMUST00000140796] [ENSMUST00000203828]
Predicted Effect probably benign
Transcript: ENSMUST00000084214
AA Change: Q1004L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: Q1004L

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084215
AA Change: Q986L

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: Q986L

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105831
AA Change: Q993L

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: Q993L

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135745
Predicted Effect probably benign
Transcript: ENSMUST00000140796
AA Change: Q428L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000115946
Gene: ENSMUSG00000028760
AA Change: Q428L

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 16 40 N/A INTRINSIC
Blast:MIF4G 41 132 2e-49 BLAST
Blast:MIF4G 146 189 3e-16 BLAST
MIF4G 192 420 1.42e-65 SMART
low complexity region 510 533 N/A INTRINSIC
MA3 639 751 9.29e-38 SMART
eIF5C 911 998 7.92e-36 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000203828
AA Change: Q1169L

PolyPhen 2 Score 0.665 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: Q1169L

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1793:Eif4g3 UTSW 4 138171131 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4608:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R4941:Eif4g3 UTSW 4 138170565 missense probably damaging 1.00
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 unclassified probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6278:Eif4g3 UTSW 4 138188083 missense possibly damaging 0.82
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6720:Eif4g3 UTSW 4 138175832 intron probably null
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense not run
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTTATGCAGTGGAAAAGTAGACGC -3'
(R):5'- TGACACACTGTAGGATGGAGC -3'

Sequencing Primer
(F):5'- CCTCCTGTGTACTGGGACTAAAG -3'
(R):5'- CTTGGTCATCAGCTGCT -3'
Posted On2014-06-23