Incidental Mutation 'R1857:Cfap69'
ID206218
Institutional Source Beutler Lab
Gene Symbol Cfap69
Ensembl Gene ENSMUSG00000040473
Gene Namecilia and flagella associated protein 69
SynonymsA330021E22Rik
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.192) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location5579278-5664239 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 5582518 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 362 (T362K)
Ref Sequence ENSEMBL: ENSMUSP00000119944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054865] [ENSMUST00000132510] [ENSMUST00000148347] [ENSMUST00000155048] [ENSMUST00000196165]
Predicted Effect probably benign
Transcript: ENSMUST00000054865
AA Change: T826K

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053206
Gene: ENSMUSG00000040473
AA Change: T826K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 847 860 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000124734
AA Change: T53K
SMART Domains Protein: ENSMUSP00000119859
Gene: ENSMUSG00000040473
AA Change: T53K

DomainStartEndE-ValueType
low complexity region 75 88 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132510
SMART Domains Protein: ENSMUSP00000122569
Gene: ENSMUSG00000040473

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000148347
AA Change: T362K

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119944
Gene: ENSMUSG00000040473
AA Change: T362K

DomainStartEndE-ValueType
low complexity region 383 396 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155048
Predicted Effect probably benign
Transcript: ENSMUST00000196165
AA Change: T655K

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000143393
Gene: ENSMUSG00000040473
AA Change: T655K

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 676 689 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199314
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit faster response kinetics and stimuli integration to olfactory stimulation and impaired olfaction a buried food pellet test with a background of the same odor. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Cfap69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Cfap69 APN 5 5584682 missense probably damaging 1.00
IGL00234:Cfap69 APN 5 5617295 missense probably benign 0.03
IGL00658:Cfap69 APN 5 5625857 missense probably damaging 1.00
IGL00901:Cfap69 APN 5 5619162 splice site probably benign
IGL01410:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01415:Cfap69 APN 5 5646979 missense probably damaging 1.00
IGL01839:Cfap69 APN 5 5626027 nonsense probably null
IGL01993:Cfap69 APN 5 5581284 missense probably damaging 0.99
IGL02821:Cfap69 APN 5 5664017 missense probably benign 0.01
IGL03212:Cfap69 APN 5 5657849 critical splice acceptor site probably null
IGL03339:Cfap69 APN 5 5586436 splice site probably benign
IGL03052:Cfap69 UTSW 5 5589206 missense probably damaging 0.97
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0049:Cfap69 UTSW 5 5613734 missense probably benign 0.45
R0387:Cfap69 UTSW 5 5589303 missense probably damaging 0.98
R0433:Cfap69 UTSW 5 5649853 missense probably damaging 0.99
R0690:Cfap69 UTSW 5 5663951 missense probably damaging 0.99
R0702:Cfap69 UTSW 5 5644465 missense probably benign 0.27
R0718:Cfap69 UTSW 5 5621924 missense probably damaging 1.00
R1525:Cfap69 UTSW 5 5640230 splice site probably null
R1670:Cfap69 UTSW 5 5586409 missense probably benign 0.27
R1677:Cfap69 UTSW 5 5582457 missense probably damaging 1.00
R1916:Cfap69 UTSW 5 5663970 missense probably damaging 0.99
R1937:Cfap69 UTSW 5 5593818 missense probably damaging 1.00
R2029:Cfap69 UTSW 5 5604306 missense probably damaging 1.00
R2106:Cfap69 UTSW 5 5595979 missense probably benign 0.05
R2177:Cfap69 UTSW 5 5625803 missense probably damaging 1.00
R2261:Cfap69 UTSW 5 5596018 missense probably damaging 0.99
R2939:Cfap69 UTSW 5 5644432 missense probably damaging 0.99
R3706:Cfap69 UTSW 5 5613843 nonsense probably null
R3876:Cfap69 UTSW 5 5584645 splice site probably benign
R3893:Cfap69 UTSW 5 5581245 missense probably damaging 1.00
R4033:Cfap69 UTSW 5 5604389 missense possibly damaging 0.87
R4760:Cfap69 UTSW 5 5646939 missense probably damaging 1.00
R4787:Cfap69 UTSW 5 5646934 critical splice donor site probably null
R4932:Cfap69 UTSW 5 5625820 missense probably damaging 1.00
R5215:Cfap69 UTSW 5 5589133 missense possibly damaging 0.82
R5258:Cfap69 UTSW 5 5604271 splice site probably null
R5596:Cfap69 UTSW 5 5626020 missense probably damaging 1.00
R5673:Cfap69 UTSW 5 5596027 missense possibly damaging 0.66
R5752:Cfap69 UTSW 5 5589204 missense probably damaging 1.00
R5933:Cfap69 UTSW 5 5640183 missense probably damaging 1.00
R6148:Cfap69 UTSW 5 5663996 missense probably benign 0.03
R6511:Cfap69 UTSW 5 5617220 missense probably damaging 0.98
R6550:Cfap69 UTSW 5 5581220 missense probably benign 0.03
R6870:Cfap69 UTSW 5 5621958 missense probably benign 0.26
X0010:Cfap69 UTSW 5 5644503 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCAGTTGACAGTCTAAGAGGCAG -3'
(R):5'- AAACCGTTTTGACCTTACCGTTTG -3'

Sequencing Primer
(F):5'- GGCTCTGACAGTAGTGATATCTTAC -3'
(R):5'- ACTCACTTTGTAGAGCAGGC -3'
Posted On2014-06-23