Incidental Mutation 'R1857:Stard13'
List |< first << previous [record 67 of 76] next >> last >|
ID206223
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151095438 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000116705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000126770] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]
Predicted Effect probably damaging
Transcript: ENSMUST00000062015
AA Change: Y75C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: Y75C

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110483
AA Change: Y75C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: Y75C

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126770
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129088
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128
AA Change: Y60C

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect probably benign
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202866
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1858:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
R7252:Stard13 UTSW 5 151063169 missense probably benign 0.01
R7318:Stard13 UTSW 5 151062573 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTTCCTAATTAGTAAATTGCTGG -3'
(R):5'- CCTGCACAGTCTCTGCATCC -3'

Sequencing Primer
(F):5'- ATTGCTGGTAGAGAATAGGAGTTG -3'
(R):5'- ATCCTCCTTCTGGGTAGACTGAC -3'
Posted On2014-06-23