Incidental Mutation 'R1857:Neurl4'
ID206252
Institutional Source Beutler Lab
Gene Symbol Neurl4
Ensembl Gene ENSMUSG00000047284
Gene Nameneuralized E3 ubiquitin protein ligase 4
Synonyms0610025P10Rik
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69901072-69913820 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 69905535 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 435 (G435V)
Ref Sequence ENSEMBL: ENSMUSP00000135185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018714] [ENSMUST00000061837] [ENSMUST00000100969] [ENSMUST00000102580] [ENSMUST00000108617] [ENSMUST00000108621] [ENSMUST00000128046] [ENSMUST00000129234] [ENSMUST00000129475] [ENSMUST00000133203] [ENSMUST00000144431] [ENSMUST00000177138] [ENSMUST00000177476]
Predicted Effect probably benign
Transcript: ENSMUST00000018714
SMART Domains Protein: ENSMUSP00000018714
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061837
AA Change: G435V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053235
Gene: ENSMUSG00000047284
AA Change: G435V

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 913 1043 2.27e-17 SMART
low complexity region 1108 1117 N/A INTRINSIC
NEUZ 1130 1250 4.93e-6 SMART
low complexity region 1453 1464 N/A INTRINSIC
low complexity region 1474 1483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100969
SMART Domains Protein: ENSMUSP00000098529
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 272 5.7e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102580
SMART Domains Protein: ENSMUSP00000099640
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 153 270 6.2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108617
AA Change: G413V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104257
Gene: ENSMUSG00000047284
AA Change: G413V

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 3.5e-31 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 2.5e-54 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 2e-48 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 2.6e-41 SMART
NEUZ 891 1021 7.6e-20 SMART
low complexity region 1086 1095 N/A INTRINSIC
NEUZ 1108 1228 1.7e-8 SMART
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1452 1461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108621
SMART Domains Protein: ENSMUSP00000104261
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Pfam:IPP-2 150 277 1.3e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128046
SMART Domains Protein: ENSMUSP00000137547
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
Pfam:IPP-2 1 77 1.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129234
SMART Domains Protein: ENSMUSP00000136835
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000129475
AA Change: G112V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135733
Gene: ENSMUSG00000047284
AA Change: G112V

DomainStartEndE-ValueType
NEUZ 1 119 4.22e-44 SMART
low complexity region 169 180 N/A INTRINSIC
low complexity region 182 201 N/A INTRINSIC
internal_repeat_1 206 246 1.46e-10 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000133203
AA Change: G178V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117917
Gene: ENSMUSG00000047284
AA Change: G178V

DomainStartEndE-ValueType
NEUZ 60 185 7.22e-52 SMART
low complexity region 235 246 N/A INTRINSIC
NEUZ 263 387 6.15e-46 SMART
low complexity region 429 443 N/A INTRINSIC
NEUZ 459 583 7.81e-39 SMART
NEUZ 656 786 2.27e-17 SMART
low complexity region 851 860 N/A INTRINSIC
Pfam:Neuralized 875 942 6.5e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143861
Predicted Effect probably benign
Transcript: ENSMUST00000144431
SMART Domains Protein: ENSMUSP00000135926
Gene: ENSMUSG00000018570

DomainStartEndE-ValueType
low complexity region 86 108 N/A INTRINSIC
low complexity region 115 127 N/A INTRINSIC
low complexity region 132 144 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176614
Predicted Effect probably damaging
Transcript: ENSMUST00000177138
AA Change: G413V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135277
Gene: ENSMUSG00000047284
AA Change: G413V

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 295 420 7.22e-52 SMART
low complexity region 470 481 N/A INTRINSIC
NEUZ 498 622 6.15e-46 SMART
low complexity region 664 678 N/A INTRINSIC
NEUZ 694 818 7.81e-39 SMART
NEUZ 889 1019 2.27e-17 SMART
low complexity region 1084 1093 N/A INTRINSIC
NEUZ 1106 1226 4.93e-6 SMART
low complexity region 1429 1440 N/A INTRINSIC
low complexity region 1450 1459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177160
Predicted Effect probably damaging
Transcript: ENSMUST00000177476
AA Change: G435V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135185
Gene: ENSMUSG00000047284
AA Change: G435V

DomainStartEndE-ValueType
low complexity region 3 44 N/A INTRINSIC
NEUZ 47 165 1.02e-28 SMART
low complexity region 207 237 N/A INTRINSIC
NEUZ 317 442 7.22e-52 SMART
low complexity region 492 503 N/A INTRINSIC
NEUZ 520 644 6.15e-46 SMART
low complexity region 686 700 N/A INTRINSIC
NEUZ 716 840 7.81e-39 SMART
NEUZ 911 1041 2.27e-17 SMART
low complexity region 1106 1115 N/A INTRINSIC
NEUZ 1128 1248 4.93e-6 SMART
low complexity region 1451 1462 N/A INTRINSIC
low complexity region 1472 1481 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted and it includes two isoforms resulting from two alternatively spliced transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Neurl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Neurl4 APN 11 69904587 missense probably damaging 1.00
IGL00516:Neurl4 APN 11 69910393 missense probably damaging 0.98
IGL01409:Neurl4 APN 11 69907099 missense probably damaging 1.00
IGL01951:Neurl4 APN 11 69909623 missense probably damaging 1.00
IGL02056:Neurl4 APN 11 69905790 missense probably damaging 1.00
IGL02206:Neurl4 APN 11 69910340 missense probably damaging 1.00
IGL02557:Neurl4 APN 11 69906335 missense probably damaging 1.00
IGL02878:Neurl4 APN 11 69906831 missense probably damaging 1.00
P0022:Neurl4 UTSW 11 69909065 missense possibly damaging 0.86
PIT4377001:Neurl4 UTSW 11 69910406 missense probably benign 0.41
R0388:Neurl4 UTSW 11 69911733 splice site probably benign
R0421:Neurl4 UTSW 11 69908534 missense probably damaging 1.00
R0449:Neurl4 UTSW 11 69905567 missense probably damaging 0.99
R1174:Neurl4 UTSW 11 69903721 critical splice donor site probably null
R1345:Neurl4 UTSW 11 69903876 missense probably benign 0.21
R1536:Neurl4 UTSW 11 69903426 nonsense probably null
R1642:Neurl4 UTSW 11 69903659 missense probably benign 0.03
R1935:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1936:Neurl4 UTSW 11 69907133 missense probably damaging 1.00
R1967:Neurl4 UTSW 11 69903210 missense possibly damaging 0.90
R1973:Neurl4 UTSW 11 69909292 missense probably benign
R2046:Neurl4 UTSW 11 69908697 missense probably damaging 1.00
R2165:Neurl4 UTSW 11 69903221 missense probably benign
R2393:Neurl4 UTSW 11 69907074 missense probably damaging 1.00
R3810:Neurl4 UTSW 11 69904033 missense probably damaging 1.00
R4299:Neurl4 UTSW 11 69909061 missense probably damaging 1.00
R4749:Neurl4 UTSW 11 69911068 missense probably benign 0.00
R4898:Neurl4 UTSW 11 69903171 missense probably damaging 0.99
R4968:Neurl4 UTSW 11 69907308 missense probably damaging 1.00
R4969:Neurl4 UTSW 11 69911087 missense probably damaging 1.00
R5503:Neurl4 UTSW 11 69906368 missense probably damaging 1.00
R6655:Neurl4 UTSW 11 69910916 critical splice donor site probably null
R6791:Neurl4 UTSW 11 69908510 missense probably damaging 1.00
R7029:Neurl4 UTSW 11 69910736 missense probably damaging 0.99
R7216:Neurl4 UTSW 11 69910262 missense probably damaging 1.00
X0025:Neurl4 UTSW 11 69906801 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTGTCTGGAAAGCAGGGAC -3'
(R):5'- ACTACACCATATACAACTGGTGGTG -3'

Sequencing Primer
(F):5'- GAAAGCAGGGACCCAGCTC -3'
(R):5'- TGTCAATGGAGTAGCTACGCC -3'
Posted On2014-06-23