Incidental Mutation 'R1857:Olfr1367'
ID206257
Institutional Source Beutler Lab
Gene Symbol Olfr1367
Ensembl Gene ENSMUSG00000045508
Gene Nameolfactory receptor 1367
SynonymsMOR256-16, MOR256-65, GA_x6K02T2QHY8-11899770-11898820
MMRRC Submission 039881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R1857 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21346910-21347964 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21347176 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 83 (M83V)
Ref Sequence ENSEMBL: ENSMUSP00000055870 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059216]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059216
AA Change: M83V

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000055870
Gene: ENSMUSG00000045508
AA Change: M83V

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.6e-54 PFAM
Pfam:7TM_GPCR_Srsx 37 153 9.3e-7 PFAM
Pfam:7tm_1 43 292 4.5e-25 PFAM
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.9%
  • 10x: 95.3%
  • 20x: 92.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,040,157 I57N probably damaging Het
Abca15 T C 7: 120,361,369 S685P probably damaging Het
Adpgk G T 9: 59,314,965 V392L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amdhd1 A T 10: 93,531,554 I246N probably damaging Het
Amhr2 T A 15: 102,446,777 L165* probably null Het
Atr T A 9: 95,865,097 I144N probably damaging Het
B020004J07Rik T C 4: 101,835,573 Y410C probably damaging Het
C87977 C T 4: 144,208,521 V217I possibly damaging Het
Ccdc33 T C 9: 58,032,708 N750S possibly damaging Het
Cdh23 A G 10: 60,323,297 I2233T probably damaging Het
Cfap46 C A 7: 139,653,408 V774F probably damaging Het
Cfap69 G T 5: 5,582,518 T362K possibly damaging Het
Cnih3 A G 1: 181,450,073 H101R probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp2j5 T C 4: 96,659,486 E173G possibly damaging Het
Cyp3a41b T A 5: 145,566,850 I296F probably benign Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dync1h1 T A 12: 110,662,625 F4205L probably damaging Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif3h T C 15: 51,799,278 Y124C probably damaging Het
Eif4g3 A T 4: 138,175,876 Q1169L possibly damaging Het
Endod1 T A 9: 14,357,109 H360L probably benign Het
Fbxo38 A G 18: 62,515,418 I683T probably damaging Het
Frem2 T A 3: 53,654,873 T738S probably benign Het
Gm1527 A T 3: 28,903,390 T148S probably damaging Het
Gm4894 T C 9: 49,278,676 S84P unknown Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il1f10 A T 2: 24,292,805 D31V possibly damaging Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp11 A T 10: 75,928,357 D91E probably benign Het
Mpped2 T C 2: 106,783,644 Y108H probably damaging Het
Mroh9 A G 1: 163,039,145 V674A probably damaging Het
Mtor G T 4: 148,480,879 Q1015H probably damaging Het
Mylk3 G A 8: 85,328,594 T711I probably damaging Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Neurl4 G T 11: 69,905,535 G435V probably damaging Het
Nipal2 A G 15: 34,678,633 S21P possibly damaging Het
Nphp1 T A 2: 127,770,376 D217V probably benign Het
Nphp3 T C 9: 104,021,294 I432T possibly damaging Het
Olfr1123 T C 2: 87,418,648 L198P probably damaging Het
Olfr681 T G 7: 105,121,544 L29R probably benign Het
Oprd1 T G 4: 132,113,681 D322A probably damaging Het
Pcdh10 C A 3: 45,379,937 Q229K possibly damaging Het
Pdlim7 G A 13: 55,506,045 T253M probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Pigc T G 1: 161,970,877 S143A possibly damaging Het
Pkd1l2 T C 8: 117,040,669 D1294G possibly damaging Het
Ppp2r1a T C 17: 20,961,689 S490P possibly damaging Het
Ppp2r3a T A 9: 101,212,893 N77I probably damaging Het
Prl7a2 A T 13: 27,659,180 C213* probably null Het
Prpf8 T A 11: 75,495,423 probably null Het
Psmd7 A T 8: 107,584,893 N109K probably damaging Het
Ptprn T C 1: 75,247,905 K936E possibly damaging Het
Ror1 A T 4: 100,441,503 Q691L probably damaging Het
Sars2 A G 7: 28,750,012 M322V probably benign Het
Scfd2 C A 5: 74,212,301 E638* probably null Het
Scgb3a2 A G 18: 43,766,835 T63A probably benign Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Smarcd1 A G 15: 99,709,414 K382E probably damaging Het
Sox5 T A 6: 143,960,815 S305C probably damaging Het
Sp5 C A 2: 70,476,869 H299Q possibly damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Tmprss6 A G 15: 78,452,552 F383L probably damaging Het
Trove2 T C 1: 143,770,750 T86A probably benign Het
Ttc23 T C 7: 67,679,073 probably null Het
Ugt2b34 T C 5: 86,904,382 T252A possibly damaging Het
Vangl2 A T 1: 172,009,897 L115Q probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vwa5b1 A G 4: 138,569,102 F1205L probably damaging Het
Zfp951 G C 5: 104,814,857 T281R probably damaging Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Olfr1367
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Olfr1367 APN 13 21347015 missense probably damaging 0.99
IGL01327:Olfr1367 APN 13 21347207 missense probably benign 0.00
IGL02624:Olfr1367 APN 13 21347512 missense probably benign 0.11
IGL02718:Olfr1367 APN 13 21347384 missense probably damaging 1.00
IGL02744:Olfr1367 APN 13 21346994 missense probably damaging 0.99
IGL03354:Olfr1367 APN 13 21347516 missense possibly damaging 0.65
R1433:Olfr1367 UTSW 13 21347024 missense probably benign 0.00
R1567:Olfr1367 UTSW 13 21347425 missense probably benign 0.00
R1858:Olfr1367 UTSW 13 21347176 missense possibly damaging 0.63
R1927:Olfr1367 UTSW 13 21346946 missense probably benign 0.04
R4627:Olfr1367 UTSW 13 21347464 missense probably damaging 1.00
R6146:Olfr1367 UTSW 13 21346994 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ATCAGTGCAGATTTCCCAGAAG -3'
(R):5'- AGAGCCTGTGGTCCATAATGAC -3'

Sequencing Primer
(F):5'- ATGGGCTTTACCAAGTACCCATGG -3'
(R):5'- GTGGTCCATAATGACAGAGTACCTC -3'
Posted On2014-06-23