Incidental Mutation 'R1858:Mdn1'
ID206298
Institutional Source Beutler Lab
Gene Symbol Mdn1
Ensembl Gene ENSMUSG00000058006
Gene Namemidasin AAA ATPase 1
Synonyms4833432B22Rik, LOC213784, D4Abb1e
MMRRC Submission 039882-MU
Accession Numbers

Genbank: NM_001081392; MGI: 1926159

Is this an essential gene? Probably essential (E-score: 0.970) question?
Stock #R1858 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location32657119-32775217 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 32730881 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 2917 (H2917Y)
Ref Sequence ENSEMBL: ENSMUSP00000136222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071642] [ENSMUST00000178134]
Predicted Effect probably benign
Transcript: ENSMUST00000071642
AA Change: H2917Y

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000071569
Gene: ENSMUSG00000058006
AA Change: H2917Y

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 7.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4672 4681 N/A INTRINSIC
low complexity region 4735 4756 N/A INTRINSIC
low complexity region 4769 4790 N/A INTRINSIC
low complexity region 4886 4905 N/A INTRINSIC
low complexity region 4924 4937 N/A INTRINSIC
coiled coil region 4957 4983 N/A INTRINSIC
low complexity region 5000 5017 N/A INTRINSIC
low complexity region 5176 5192 N/A INTRINSIC
low complexity region 5315 5329 N/A INTRINSIC
VWA 5375 5556 2.73e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125323
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150934
Predicted Effect probably benign
Transcript: ENSMUST00000178134
AA Change: H2917Y

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136222
Gene: ENSMUSG00000058006
AA Change: H2917Y

DomainStartEndE-ValueType
low complexity region 48 75 N/A INTRINSIC
low complexity region 258 270 N/A INTRINSIC
Pfam:AAA_5 324 459 4.4e-19 PFAM
AAA 666 908 1.06e-6 SMART
AAA 1072 1217 2.09e-1 SMART
AAA 1378 1544 8.27e-9 SMART
AAA 1740 1893 6.78e-2 SMART
AAA 2053 2309 1.62e0 SMART
low complexity region 3181 3193 N/A INTRINSIC
low complexity region 3541 3552 N/A INTRINSIC
low complexity region 3557 3565 N/A INTRINSIC
low complexity region 4189 4203 N/A INTRINSIC
low complexity region 4339 4353 N/A INTRINSIC
low complexity region 4667 4676 N/A INTRINSIC
low complexity region 4730 4751 N/A INTRINSIC
low complexity region 4764 4785 N/A INTRINSIC
low complexity region 4881 4900 N/A INTRINSIC
low complexity region 4919 4932 N/A INTRINSIC
coiled coil region 4952 4978 N/A INTRINSIC
low complexity region 4992 5010 N/A INTRINSIC
low complexity region 5169 5185 N/A INTRINSIC
low complexity region 5308 5322 N/A INTRINSIC
VWA 5368 5549 2.73e-6 SMART
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
Allele List at MGI

All alleles(29) : Targeted, other(2) Gene trapped(27)

Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,974,953 A443E unknown Het
Acacb A T 5: 114,196,709 Y613F probably benign Het
Adam23 A C 1: 63,557,456 I566L probably benign Het
Adar G T 3: 89,739,282 R338L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amotl1 T A 9: 14,575,401 Q399L probably benign Het
Ankrd16 T G 2: 11,778,596 L3R probably benign Het
Arfgap1 G C 2: 180,974,088 G187R probably damaging Het
Arhgap19 A T 19: 41,779,153 V399D probably benign Het
Arl4d A G 11: 101,666,752 T35A probably damaging Het
Atr T A 9: 95,865,097 I144N probably damaging Het
Bptf A G 11: 107,073,301 M1574T probably benign Het
Cacna1h T A 17: 25,380,807 D1684V probably damaging Het
Celsr1 C A 15: 86,032,759 V338F probably damaging Het
Cep164 T C 9: 45,823,640 probably benign Het
Clock C A 5: 76,240,909 G390C possibly damaging Het
Col6a6 A G 9: 105,781,102 F637S probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cul1 A G 6: 47,525,524 probably null Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp3a57 T C 5: 145,381,249 Y347H probably damaging Het
Dgkq G T 5: 108,653,731 T487K probably benign Het
Dmkn T C 7: 30,764,565 V143A probably benign Het
Dmp1 A T 5: 104,207,630 E32V possibly damaging Het
Dsc3 T C 18: 19,965,716 D802G probably damaging Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dusp27 T C 1: 166,100,846 Y399C possibly damaging Het
Dyrk1b A T 7: 28,182,646 probably null Het
Ehd2 T C 7: 15,952,188 T320A probably benign Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif4e1b A G 13: 54,787,278 probably null Het
Fam131b A G 6: 42,318,980 F161L probably damaging Het
Fam171b A T 2: 83,853,381 M81L probably benign Het
Gal3st4 T C 5: 138,270,788 probably null Het
Gdf11 A T 10: 128,886,446 V180E probably damaging Het
Gm4758 A T 16: 36,308,087 I15F probably damaging Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Grin3a T A 4: 49,792,437 Y432F probably benign Het
Hif1a C A 12: 73,944,155 H708N probably benign Het
Hmcn2 G T 2: 31,415,283 probably null Het
Hrasls G A 16: 29,217,718 G36D probably damaging Het
Hs3st6 T A 17: 24,757,999 M151K possibly damaging Het
Hyal2 T A 9: 107,572,338 L431Q probably benign Het
Hyal6 A T 6: 24,740,858 T337S probably benign Het
Igsf5 A T 16: 96,386,629 probably null Het
Kif13a G A 13: 46,864,838 probably benign Het
Krtap19-3 G A 16: 88,877,990 probably benign Het
Lgalsl T C 11: 20,829,420 D75G probably benign Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Ltbp2 T A 12: 84,830,781 K337* probably null Het
Medag A G 5: 149,429,794 I151M probably damaging Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp3 A G 9: 7,451,799 H379R probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Ncoa6 G T 2: 155,421,639 Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nlrp4c A G 7: 6,084,656 I763V probably benign Het
Nlrp5 A T 7: 23,418,161 I437F probably damaging Het
Noc2l G A 4: 156,245,270 R435Q probably damaging Het
Nova2 T C 7: 18,958,401 I485T probably damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Nup210l A G 3: 90,154,499 T662A probably damaging Het
Olfr1014 T C 2: 85,777,238 L218P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr1368 A T 13: 21,142,394 I221N probably damaging Het
Olfr1370 A T 13: 21,072,471 F277I probably damaging Het
Olfr606 G A 7: 103,452,125 V263I probably benign Het
Olfr612 G A 7: 103,538,652 T194I probably damaging Het
Olfr78 A C 7: 102,742,364 I213S probably damaging Het
Pelp1 G A 11: 70,394,742 P767S probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Plcxd3 T A 15: 4,516,611 probably benign Het
Plekhg1 C A 10: 3,945,917 D436E possibly damaging Het
Ppfibp1 G A 6: 146,990,592 V117I probably benign Het
Prss44 A G 9: 110,814,109 K24R probably benign Het
Ptger1 G T 8: 83,668,478 G195W probably benign Het
Ptgs1 A C 2: 36,242,770 D260A probably benign Het
Ptprd T A 4: 75,947,147 T1198S probably damaging Het
Qsox2 A G 2: 26,214,062 S319P probably damaging Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rapgef4 A G 2: 72,031,064 I33V possibly damaging Het
Rbbp8nl C T 2: 180,282,213 probably benign Het
Riok1 A T 13: 38,058,718 K473* probably null Het
Rtca C T 3: 116,494,115 G288S probably benign Het
Sag A T 1: 87,814,848 D114V probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sec61g A G 11: 16,506,371 probably null Het
Sf3a3 A T 4: 124,729,495 I440F probably damaging Het
Sgta T C 10: 81,048,861 K205E possibly damaging Het
Slc36a4 A G 9: 15,720,710 T61A probably damaging Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Srgap3 A T 6: 112,771,518 L391Q probably damaging Het
Stard13 T C 5: 151,095,438 Y60C probably damaging Het
Syt12 G T 19: 4,447,797 H386N probably damaging Het
Thyn1 T A 9: 27,003,774 M74K probably benign Het
Tmem130 C A 5: 144,752,283 probably null Het
Trim71 A G 9: 114,562,948 V57A possibly damaging Het
Twf1 T C 15: 94,585,547 probably benign Het
Tyro3 T A 2: 119,801,695 I81N possibly damaging Het
Unc13a A T 8: 71,652,399 C740S probably damaging Het
Vmn1r15 A T 6: 57,258,631 K161N probably benign Het
Vmn1r16 A T 6: 57,322,899 I246N probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vmn2r35 T C 7: 7,816,806 Y155C possibly damaging Het
Wif1 T A 10: 121,083,883 probably null Het
Wscd2 G A 5: 113,551,170 R79Q possibly damaging Het
Zan G T 5: 137,405,877 probably benign Het
Zfp9 G T 6: 118,465,060 H214N probably benign Het
Zfp985 A T 4: 147,582,858 Y61F probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Mdn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Mdn1 APN 4 32723651 missense probably damaging 1.00
IGL00426:Mdn1 APN 4 32719214 missense possibly damaging 0.91
IGL00570:Mdn1 APN 4 32735719 missense probably benign
IGL00573:Mdn1 APN 4 32666619 critical splice donor site probably null
IGL00983:Mdn1 APN 4 32735525 missense probably damaging 1.00
IGL01288:Mdn1 APN 4 32730864 missense probably benign 0.00
IGL01359:Mdn1 APN 4 32743686 missense probably benign 0.10
IGL01457:Mdn1 APN 4 32715922 missense possibly damaging 0.82
IGL01530:Mdn1 APN 4 32711938 splice site probably benign
IGL01684:Mdn1 APN 4 32726857 missense probably benign
IGL01753:Mdn1 APN 4 32708483 missense probably benign
IGL01901:Mdn1 APN 4 32669591 missense probably damaging 1.00
IGL01952:Mdn1 APN 4 32723657 missense possibly damaging 0.82
IGL01960:Mdn1 APN 4 32758393 missense probably benign 0.14
IGL02019:Mdn1 APN 4 32749948 missense possibly damaging 0.93
IGL02100:Mdn1 APN 4 32715708 missense possibly damaging 0.90
IGL02117:Mdn1 APN 4 32709364 missense probably benign 0.00
IGL02154:Mdn1 APN 4 32740395 missense probably benign 0.35
IGL02216:Mdn1 APN 4 32739092 missense probably benign 0.03
IGL02371:Mdn1 APN 4 32676860
IGL02396:Mdn1 APN 4 32700120 missense probably damaging 0.99
IGL02454:Mdn1 APN 4 32694674 critical splice donor site probably null
IGL02502:Mdn1 APN 4 32670579 missense possibly damaging 0.69
IGL02883:Mdn1 APN 4 32763199 missense probably benign 0.05
IGL02946:Mdn1 APN 4 32734366 missense probably damaging 0.98
IGL02950:Mdn1 APN 4 32713360 splice site probably benign
IGL03076:Mdn1 APN 4 32735564 missense probably damaging 0.97
IGL03129:Mdn1 APN 4 32729994 missense possibly damaging 0.47
IGL03234:Mdn1 APN 4 32732842 missense probably benign 0.06
3-1:Mdn1 UTSW 4 32725967 critical splice donor site probably null
IGL03046:Mdn1 UTSW 4 32694495 missense possibly damaging 0.73
P0035:Mdn1 UTSW 4 32749934 missense probably benign 0.05
R0008:Mdn1 UTSW 4 32718317 missense possibly damaging 0.47
R0110:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0125:Mdn1 UTSW 4 32729956 missense probably damaging 0.98
R0257:Mdn1 UTSW 4 32693534 missense probably damaging 0.99
R0266:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0349:Mdn1 UTSW 4 32750318 missense probably damaging 1.00
R0362:Mdn1 UTSW 4 32746439 critical splice acceptor site probably null
R0421:Mdn1 UTSW 4 32684707 missense probably benign 0.39
R0450:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0465:Mdn1 UTSW 4 32699204 splice site probably benign
R0469:Mdn1 UTSW 4 32738619 missense probably benign 0.20
R0477:Mdn1 UTSW 4 32750928 missense probably benign 0.02
R0481:Mdn1 UTSW 4 32767182 splice site probably benign
R0504:Mdn1 UTSW 4 32698916 splice site probably benign
R0522:Mdn1 UTSW 4 32672837 missense probably benign 0.09
R0550:Mdn1 UTSW 4 32730479 missense probably benign 0.13
R0607:Mdn1 UTSW 4 32712014 missense probably damaging 1.00
R0607:Mdn1 UTSW 4 32732829 missense probably benign 0.36
R0664:Mdn1 UTSW 4 32768011 nonsense probably null
R0701:Mdn1 UTSW 4 32699263 missense probably benign 0.00
R0801:Mdn1 UTSW 4 32668895 missense probably benign 0.04
R0841:Mdn1 UTSW 4 32752032 missense probably benign 0.23
R0849:Mdn1 UTSW 4 32741835 missense probably damaging 0.99
R0893:Mdn1 UTSW 4 32701713 missense probably benign 0.01
R1114:Mdn1 UTSW 4 32746568 critical splice donor site probably null
R1137:Mdn1 UTSW 4 32694511 missense probably damaging 1.00
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1185:Mdn1 UTSW 4 32735576 missense possibly damaging 0.94
R1257:Mdn1 UTSW 4 32667089 critical splice acceptor site probably null
R1356:Mdn1 UTSW 4 32700334 splice site probably benign
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1466:Mdn1 UTSW 4 32730788 missense probably benign 0.28
R1518:Mdn1 UTSW 4 32739977 missense probably damaging 1.00
R1569:Mdn1 UTSW 4 32723501 missense probably null 0.10
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1574:Mdn1 UTSW 4 32722315 missense probably benign
R1591:Mdn1 UTSW 4 32700092 missense possibly damaging 0.65
R1678:Mdn1 UTSW 4 32663050 missense probably damaging 0.99
R1696:Mdn1 UTSW 4 32700417 missense possibly damaging 0.91
R1707:Mdn1 UTSW 4 32693504 missense probably damaging 1.00
R1749:Mdn1 UTSW 4 32773952 missense probably damaging 1.00
R1780:Mdn1 UTSW 4 32700103 missense probably damaging 1.00
R1833:Mdn1 UTSW 4 32720761 missense probably damaging 0.97
R1870:Mdn1 UTSW 4 32763339 missense probably damaging 1.00
R1887:Mdn1 UTSW 4 32742540 missense probably damaging 1.00
R1909:Mdn1 UTSW 4 32760839 small deletion probably benign
R2075:Mdn1 UTSW 4 32716058 missense probably benign 0.03
R2103:Mdn1 UTSW 4 32738712 missense possibly damaging 0.75
R2104:Mdn1 UTSW 4 32743843 splice site probably null
R2110:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2111:Mdn1 UTSW 4 32700409 missense probably damaging 1.00
R2206:Mdn1 UTSW 4 32716271 missense possibly damaging 0.71
R2221:Mdn1 UTSW 4 32763306 missense probably benign 0.37
R2240:Mdn1 UTSW 4 32765701 missense possibly damaging 0.90
R2351:Mdn1 UTSW 4 32750010 missense probably benign 0.21
R2421:Mdn1 UTSW 4 32723621 missense probably damaging 0.96
R3036:Mdn1 UTSW 4 32750013 missense probably damaging 0.99
R3434:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3435:Mdn1 UTSW 4 32733726 critical splice donor site probably null
R3783:Mdn1 UTSW 4 32720818 missense probably benign 0.01
R3811:Mdn1 UTSW 4 32693506 nonsense probably null
R3973:Mdn1 UTSW 4 32722363 missense probably benign 0.00
R4154:Mdn1 UTSW 4 32707475 missense probably damaging 0.96
R4372:Mdn1 UTSW 4 32743809 missense probably benign 0.03
R4393:Mdn1 UTSW 4 32754482 missense possibly damaging 0.48
R4438:Mdn1 UTSW 4 32704635 missense probably damaging 1.00
R4471:Mdn1 UTSW 4 32668860 missense probably benign 0.00
R4509:Mdn1 UTSW 4 32715883 missense probably damaging 1.00
R4538:Mdn1 UTSW 4 32722334 missense probably damaging 1.00
R4557:Mdn1 UTSW 4 32754437 missense probably damaging 1.00
R4570:Mdn1 UTSW 4 32741812 missense probably damaging 1.00
R4591:Mdn1 UTSW 4 32707636 missense probably damaging 1.00
R4658:Mdn1 UTSW 4 32730749 splice site probably null
R4667:Mdn1 UTSW 4 32679572 missense probably damaging 1.00
R4684:Mdn1 UTSW 4 32666430 missense probably damaging 1.00
R4778:Mdn1 UTSW 4 32683583 nonsense probably null
R4807:Mdn1 UTSW 4 32685651 splice site probably null
R4923:Mdn1 UTSW 4 32671608 missense possibly damaging 0.89
R4951:Mdn1 UTSW 4 32707459 missense probably damaging 1.00
R4963:Mdn1 UTSW 4 32756512 missense probably benign 0.00
R4971:Mdn1 UTSW 4 32739827 missense probably damaging 1.00
R4973:Mdn1 UTSW 4 32734418 missense probably benign 0.01
R5122:Mdn1 UTSW 4 32670593 missense probably damaging 1.00
R5159:Mdn1 UTSW 4 32774008 missense possibly damaging 0.93
R5164:Mdn1 UTSW 4 32759011 intron probably null
R5215:Mdn1 UTSW 4 32741418 missense possibly damaging 0.78
R5217:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5219:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5365:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5366:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5368:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5445:Mdn1 UTSW 4 32723690 missense probably damaging 0.98
R5462:Mdn1 UTSW 4 32720897 missense probably benign
R5522:Mdn1 UTSW 4 32685783 missense probably damaging 1.00
R5525:Mdn1 UTSW 4 32767961 missense possibly damaging 0.73
R5578:Mdn1 UTSW 4 32728167 missense probably benign 0.04
R5605:Mdn1 UTSW 4 32765664 missense probably benign
R5621:Mdn1 UTSW 4 32716371 missense possibly damaging 0.46
R5636:Mdn1 UTSW 4 32695480 missense probably damaging 1.00
R5650:Mdn1 UTSW 4 32667467 splice site probably null
R5780:Mdn1 UTSW 4 32722950 missense probably benign 0.02
R5838:Mdn1 UTSW 4 32754547 missense probably damaging 0.99
R5857:Mdn1 UTSW 4 32670646 missense probably benign 0.09
R5895:Mdn1 UTSW 4 32695400 missense probably damaging 1.00
R5943:Mdn1 UTSW 4 32678330 missense probably damaging 1.00
R6008:Mdn1 UTSW 4 32741073 missense probably damaging 1.00
R6013:Mdn1 UTSW 4 32715713 missense probably damaging 1.00
R6075:Mdn1 UTSW 4 32689581 missense possibly damaging 0.48
R6151:Mdn1 UTSW 4 32684735 missense probably damaging 1.00
R6163:Mdn1 UTSW 4 32716040 missense probably damaging 1.00
R6181:Mdn1 UTSW 4 32715953 missense probably damaging 1.00
R6211:Mdn1 UTSW 4 32696269 missense probably benign 0.12
R6249:Mdn1 UTSW 4 32708484 missense possibly damaging 0.85
R6251:Mdn1 UTSW 4 32748590 missense probably benign 0.13
R6253:Mdn1 UTSW 4 32749593 missense probably benign 0.25
R6273:Mdn1 UTSW 4 32715979 missense probably benign 0.01
R6297:Mdn1 UTSW 4 32730054 nonsense probably null
R6384:Mdn1 UTSW 4 32670607 missense probably damaging 1.00
R6463:Mdn1 UTSW 4 32773308 missense probably damaging 1.00
R6528:Mdn1 UTSW 4 32713780 missense probably damaging 1.00
R6688:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
R6762:Mdn1 UTSW 4 32676786 missense possibly damaging 0.50
R6794:Mdn1 UTSW 4 32741893 missense probably damaging 1.00
R6894:Mdn1 UTSW 4 32748614 missense possibly damaging 0.75
R6935:Mdn1 UTSW 4 32774041 missense possibly damaging 0.74
X0066:Mdn1 UTSW 4 32739030 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCGTGGACTTAGACTGC -3'
(R):5'- AAGGAAAAGACTGGTCTCCCCG -3'

Sequencing Primer
(F):5'- CCGTGGACTTAGACTGCATTGTTC -3'
(R):5'- AAGACTGGTCTCCCCGTACCTC -3'
Posted On2014-06-23