Incidental Mutation 'R1858:Stard13'
ID206318
Institutional Source Beutler Lab
Gene Symbol Stard13
Ensembl Gene ENSMUSG00000016128
Gene NameStAR-related lipid transfer (START) domain containing 13
SynonymsGT650, DLC2
MMRRC Submission 039882-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1858 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location151037510-151233836 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151095438 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 60 (Y60C)
Ref Sequence ENSEMBL: ENSMUSP00000116705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000126770] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]
Predicted Effect probably damaging
Transcript: ENSMUST00000062015
AA Change: Y75C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: Y75C

DomainStartEndE-ValueType
Pfam:SAM_2 59 120 2.6e-6 PFAM
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 693 884 2.37e-50 SMART
START 927 1129 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110483
AA Change: Y75C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: Y75C

DomainStartEndE-ValueType
PDB:2JW2|A 50 120 1e-37 PDB
low complexity region 197 216 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 612 624 N/A INTRINSIC
RhoGAP 674 865 2.37e-50 SMART
START 908 1110 2.08e-40 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000126770
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122468
Gene: ENSMUSG00000016128
AA Change: Y60C

DomainStartEndE-ValueType
Pfam:SAM_2 44 105 7.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129088
AA Change: Y60C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128
AA Change: Y60C

DomainStartEndE-ValueType
Blast:SAM 40 104 6e-32 BLAST
PDB:2JW2|A 42 104 8e-33 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201680
Predicted Effect probably benign
Transcript: ENSMUST00000202111
SMART Domains Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128

DomainStartEndE-ValueType
low complexity region 79 98 N/A INTRINSIC
low complexity region 204 222 N/A INTRINSIC
low complexity region 355 368 N/A INTRINSIC
low complexity region 494 506 N/A INTRINSIC
RhoGAP 556 747 1.4e-52 SMART
START 790 992 1.4e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202866
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.7%
  • 10x: 94.8%
  • 20x: 91.0%
Validation Efficiency 97% (112/116)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A830018L16Rik C A 1: 11,974,953 A443E unknown Het
Acacb A T 5: 114,196,709 Y613F probably benign Het
Adam23 A C 1: 63,557,456 I566L probably benign Het
Adar G T 3: 89,739,282 R338L probably benign Het
Akap14 C T X: 37,157,126 A476T probably damaging Het
Amotl1 T A 9: 14,575,401 Q399L probably benign Het
Ankrd16 T G 2: 11,778,596 L3R probably benign Het
Arfgap1 G C 2: 180,974,088 G187R probably damaging Het
Arhgap19 A T 19: 41,779,153 V399D probably benign Het
Arl4d A G 11: 101,666,752 T35A probably damaging Het
Atr T A 9: 95,865,097 I144N probably damaging Het
Bptf A G 11: 107,073,301 M1574T probably benign Het
Cacna1h T A 17: 25,380,807 D1684V probably damaging Het
Celsr1 C A 15: 86,032,759 V338F probably damaging Het
Cep164 T C 9: 45,823,640 probably benign Het
Clock C A 5: 76,240,909 G390C possibly damaging Het
Col6a6 A G 9: 105,781,102 F637S probably damaging Het
Crebrf T A 17: 26,742,963 Y345N probably benign Het
Cul1 A G 6: 47,525,524 probably null Het
Cyb5r4 C T 9: 87,041,279 S185L probably benign Het
Cyp3a57 T C 5: 145,381,249 Y347H probably damaging Het
Dgkq G T 5: 108,653,731 T487K probably benign Het
Dmkn T C 7: 30,764,565 V143A probably benign Het
Dmp1 A T 5: 104,207,630 E32V possibly damaging Het
Dsc3 T C 18: 19,965,716 D802G probably damaging Het
Dse T C 10: 34,153,229 T622A probably benign Het
Dusp27 T C 1: 166,100,846 Y399C possibly damaging Het
Dyrk1b A T 7: 28,182,646 probably null Het
Ehd2 T C 7: 15,952,188 T320A probably benign Het
Eif3a A C 19: 60,782,197 L71V probably damaging Het
Eif4e1b A G 13: 54,787,278 probably null Het
Fam131b A G 6: 42,318,980 F161L probably damaging Het
Fam171b A T 2: 83,853,381 M81L probably benign Het
Gal3st4 T C 5: 138,270,788 probably null Het
Gdf11 A T 10: 128,886,446 V180E probably damaging Het
Gm4758 A T 16: 36,308,087 I15F probably damaging Het
Gm4981 A G 10: 58,235,780 V204A probably benign Het
Grin3a T A 4: 49,792,437 Y432F probably benign Het
Hif1a C A 12: 73,944,155 H708N probably benign Het
Hmcn2 G T 2: 31,415,283 probably null Het
Hrasls G A 16: 29,217,718 G36D probably damaging Het
Hs3st6 T A 17: 24,757,999 M151K possibly damaging Het
Hyal2 T A 9: 107,572,338 L431Q probably benign Het
Hyal6 A T 6: 24,740,858 T337S probably benign Het
Igsf5 A T 16: 96,386,629 probably null Het
Kif13a G A 13: 46,864,838 probably benign Het
Krtap19-3 G A 16: 88,877,990 probably benign Het
Lgalsl T C 11: 20,829,420 D75G probably benign Het
Lrrc56 A G 7: 141,207,508 M353V probably benign Het
Ltbp2 T A 12: 84,830,781 K337* probably null Het
Mdn1 C T 4: 32,730,881 H2917Y probably benign Het
Medag A G 5: 149,429,794 I151M probably damaging Het
Meiob T C 17: 24,823,570 V124A probably damaging Het
Mmp3 A G 9: 7,451,799 H379R probably benign Het
Mpg A G 11: 32,231,957 probably null Het
Ncoa6 G T 2: 155,421,639 Q292K probably benign Het
Ndufaf6 G T 4: 11,053,474 H277Q probably benign Het
Nlrp4c A G 7: 6,084,656 I763V probably benign Het
Nlrp5 A T 7: 23,418,161 I437F probably damaging Het
Noc2l G A 4: 156,245,270 R435Q probably damaging Het
Nova2 T C 7: 18,958,401 I485T probably damaging Het
Nrxn2 G A 19: 6,488,795 V794I probably benign Het
Nup210l A G 3: 90,154,499 T662A probably damaging Het
Olfr1014 T C 2: 85,777,238 L218P probably damaging Het
Olfr1367 A G 13: 21,347,176 M83V possibly damaging Het
Olfr1368 A T 13: 21,142,394 I221N probably damaging Het
Olfr1370 A T 13: 21,072,471 F277I probably damaging Het
Olfr606 G A 7: 103,452,125 V263I probably benign Het
Olfr612 G A 7: 103,538,652 T194I probably damaging Het
Olfr78 A C 7: 102,742,364 I213S probably damaging Het
Pelp1 G A 11: 70,394,742 P767S probably damaging Het
Pfdn1 C A 18: 36,451,100 M60I probably benign Het
Plcxd3 T A 15: 4,516,611 probably benign Het
Plekhg1 C A 10: 3,945,917 D436E possibly damaging Het
Ppfibp1 G A 6: 146,990,592 V117I probably benign Het
Prss44 A G 9: 110,814,109 K24R probably benign Het
Ptger1 G T 8: 83,668,478 G195W probably benign Het
Ptgs1 A C 2: 36,242,770 D260A probably benign Het
Ptprd T A 4: 75,947,147 T1198S probably damaging Het
Qsox2 A G 2: 26,214,062 S319P probably damaging Het
Rab35 A G 5: 115,640,088 I38V probably damaging Het
Rapgef4 A G 2: 72,031,064 I33V possibly damaging Het
Rbbp8nl C T 2: 180,282,213 probably benign Het
Riok1 A T 13: 38,058,718 K473* probably null Het
Rtca C T 3: 116,494,115 G288S probably benign Het
Sag A T 1: 87,814,848 D114V probably benign Het
Sdk2 C T 11: 113,838,646 silent Het
Sec61g A G 11: 16,506,371 probably null Het
Sf3a3 A T 4: 124,729,495 I440F probably damaging Het
Sgta T C 10: 81,048,861 K205E possibly damaging Het
Slc36a4 A G 9: 15,720,710 T61A probably damaging Het
Slc5a4a T C 10: 76,166,735 S242P probably benign Het
Srgap3 A T 6: 112,771,518 L391Q probably damaging Het
Syt12 G T 19: 4,447,797 H386N probably damaging Het
Thyn1 T A 9: 27,003,774 M74K probably benign Het
Tmem130 C A 5: 144,752,283 probably null Het
Trim71 A G 9: 114,562,948 V57A possibly damaging Het
Twf1 T C 15: 94,585,547 probably benign Het
Tyro3 T A 2: 119,801,695 I81N possibly damaging Het
Unc13a A T 8: 71,652,399 C740S probably damaging Het
Vmn1r15 A T 6: 57,258,631 K161N probably benign Het
Vmn1r16 A T 6: 57,322,899 I246N probably damaging Het
Vmn1r42 A G 6: 89,844,615 I324T probably benign Het
Vmn2r35 T C 7: 7,816,806 Y155C possibly damaging Het
Wif1 T A 10: 121,083,883 probably null Het
Wscd2 G A 5: 113,551,170 R79Q possibly damaging Het
Zan G T 5: 137,405,877 probably benign Het
Zfp9 G T 6: 118,465,060 H214N probably benign Het
Zfp985 A T 4: 147,582,858 Y61F probably benign Het
Zscan30 A G 18: 23,971,467 noncoding transcript Het
Other mutations in Stard13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Stard13 APN 5 151042239 missense probably damaging 1.00
IGL01362:Stard13 APN 5 151189952 missense probably benign 0.05
IGL01588:Stard13 APN 5 151045237 missense probably damaging 1.00
IGL01947:Stard13 APN 5 151062844 missense probably damaging 1.00
IGL02294:Stard13 APN 5 151063115 missense probably benign 0.19
IGL02713:Stard13 APN 5 151042186 nonsense probably null
IGL02746:Stard13 APN 5 151046857 splice site probably benign
IGL02827:Stard13 APN 5 151063126 missense probably benign 0.07
R0498:Stard13 UTSW 5 151052477 missense probably damaging 1.00
R1427:Stard13 UTSW 5 151045991 missense probably damaging 0.99
R1785:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R1857:Stard13 UTSW 5 151095438 missense probably damaging 1.00
R2130:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2131:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2132:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2133:Stard13 UTSW 5 151045168 missense probably damaging 1.00
R2258:Stard13 UTSW 5 151039731 missense probably damaging 1.00
R3435:Stard13 UTSW 5 151042179 missense probably damaging 1.00
R4080:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4081:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4082:Stard13 UTSW 5 151092829 critical splice acceptor site probably null
R4233:Stard13 UTSW 5 151062699 missense probably benign 0.00
R4288:Stard13 UTSW 5 151045177 missense probably damaging 1.00
R4303:Stard13 UTSW 5 151062869 missense possibly damaging 0.82
R4659:Stard13 UTSW 5 151062788 missense probably benign 0.01
R4695:Stard13 UTSW 5 151060815 missense probably benign 0.08
R4910:Stard13 UTSW 5 151062527 missense probably benign
R5135:Stard13 UTSW 5 151062767 nonsense probably null
R5338:Stard13 UTSW 5 151059598 missense probably damaging 1.00
R5399:Stard13 UTSW 5 151047801 nonsense probably null
R5546:Stard13 UTSW 5 151045901 missense probably benign 0.03
R5685:Stard13 UTSW 5 151063127 missense possibly damaging 0.78
R5771:Stard13 UTSW 5 151190011 missense probably damaging 1.00
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6034:Stard13 UTSW 5 151095500 splice site probably null
R6141:Stard13 UTSW 5 151042242 missense probably damaging 1.00
R6171:Stard13 UTSW 5 151092762 missense probably damaging 1.00
R6296:Stard13 UTSW 5 151062673 missense probably damaging 1.00
R6326:Stard13 UTSW 5 151046919 missense possibly damaging 0.95
R6508:Stard13 UTSW 5 151063289 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ATTGCTGGTAGAGAATAGGAGTTGG -3'
(R):5'- CAGAACGGTGCTTCATGTGG -3'

Sequencing Primer
(F):5'- AGAATAGGAGTTGGGGATTGTTTAG -3'
(R):5'- TTCATGTGGCCTGCACAG -3'
Posted On2014-06-23