Incidental Mutation 'R0114:Arhgef10l'
ID20634
Institutional Source Beutler Lab
Gene Symbol Arhgef10l
Ensembl Gene ENSMUSG00000040964
Gene NameRho guanine nucleotide exchange factor (GEF) 10-like
Synonyms2810441C07Rik
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R0114 (G1)
Quality Score158
Status Validated (trace)
Chromosome4
Chromosomal Location140514485-140666012 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 140583883 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 218 (E218G)
Ref Sequence ENSEMBL: ENSMUSP00000095431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039204] [ENSMUST00000069623] [ENSMUST00000097820] [ENSMUST00000105797] [ENSMUST00000105798] [ENSMUST00000105799] [ENSMUST00000147426]
Predicted Effect probably benign
Transcript: ENSMUST00000039204
AA Change: E257G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040531
Gene: ENSMUSG00000040964
AA Change: E257G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 748 3e-82 BLAST
low complexity region 821 833 N/A INTRINSIC
low complexity region 864 876 N/A INTRINSIC
Blast:WD40 1217 1270 8e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000069623
AA Change: E218G

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000066249
Gene: ENSMUSG00000040964
AA Change: E218G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 714 5e-80 BLAST
low complexity region 787 799 N/A INTRINSIC
low complexity region 830 842 N/A INTRINSIC
Blast:WD40 1183 1236 7e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000097820
AA Change: E218G

PolyPhen 2 Score 0.171 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000095431
Gene: ENSMUSG00000040964
AA Change: E218G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 279 461 1.95e-52 SMART
Blast:PH 496 709 3e-82 BLAST
low complexity region 782 794 N/A INTRINSIC
low complexity region 825 837 N/A INTRINSIC
Blast:WD40 1178 1231 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105797
SMART Domains Protein: ENSMUSP00000101423
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
Pfam:RhoGEF 101 183 7.1e-15 PFAM
low complexity region 195 213 N/A INTRINSIC
Blast:PH 248 461 7e-83 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 577 589 N/A INTRINSIC
Blast:WD40 618 656 6e-15 BLAST
Blast:WD40 930 983 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105798
AA Change: E17G

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101424
Gene: ENSMUSG00000040964
AA Change: E17G

DomainStartEndE-ValueType
RhoGEF 78 260 1.95e-52 SMART
Blast:PH 295 513 8e-81 BLAST
low complexity region 586 598 N/A INTRINSIC
low complexity region 629 641 N/A INTRINSIC
Blast:WD40 982 1035 6e-18 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105799
AA Change: E257G

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101425
Gene: ENSMUSG00000040964
AA Change: E257G

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 28 49 N/A INTRINSIC
low complexity region 78 89 N/A INTRINSIC
low complexity region 105 116 N/A INTRINSIC
low complexity region 170 184 N/A INTRINSIC
RhoGEF 318 500 1.95e-52 SMART
Blast:PH 535 753 5e-80 BLAST
low complexity region 826 838 N/A INTRINSIC
low complexity region 869 881 N/A INTRINSIC
Blast:WD40 1222 1275 8e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125045
Predicted Effect probably benign
Transcript: ENSMUST00000147426
SMART Domains Protein: ENSMUSP00000123642
Gene: ENSMUSG00000040964

DomainStartEndE-ValueType
low complexity region 50 62 N/A INTRINSIC
RhoGEF 101 262 5.44e-33 SMART
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the RhoGEF subfamily of RhoGTPases. Members of this subfamily are activated by specific guanine nucleotide exchange factors (GEFs) and are involved in signal transduction. The encoded protein shows cytosolic distribution. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2016]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppfibp1 A G 6: 146,998,233 R141G probably benign Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Arhgef10l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Arhgef10l APN 4 140570338 missense probably damaging 0.98
IGL01732:Arhgef10l APN 4 140580415 missense probably damaging 0.99
IGL01988:Arhgef10l APN 4 140578361 splice site probably benign
IGL02031:Arhgef10l APN 4 140575345 missense probably damaging 1.00
IGL02253:Arhgef10l APN 4 140544284 nonsense probably null
IGL02445:Arhgef10l APN 4 140547007 missense probably benign 0.19
IGL02619:Arhgef10l APN 4 140594193 missense probably benign 0.07
IGL02798:Arhgef10l APN 4 140565130 critical splice donor site probably null
IGL03064:Arhgef10l APN 4 140579279 missense probably damaging 1.00
IGL03178:Arhgef10l APN 4 140544428 missense possibly damaging 0.92
IGL03236:Arhgef10l APN 4 140611360 missense probably damaging 1.00
IGL03352:Arhgef10l APN 4 140583931 start codon destroyed probably null 0.99
R0057:Arhgef10l UTSW 4 140611218 splice site probably benign
R0062:Arhgef10l UTSW 4 140552532 missense probably damaging 1.00
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0109:Arhgef10l UTSW 4 140578294 missense probably benign 0.02
R0334:Arhgef10l UTSW 4 140583926 nonsense probably null
R0742:Arhgef10l UTSW 4 140536845 missense probably damaging 1.00
R1017:Arhgef10l UTSW 4 140515306 missense probably damaging 0.99
R1166:Arhgef10l UTSW 4 140575270 unclassified probably benign
R1397:Arhgef10l UTSW 4 140544443 missense probably damaging 0.98
R1521:Arhgef10l UTSW 4 140515438 missense possibly damaging 0.95
R1707:Arhgef10l UTSW 4 140564289 missense probably damaging 1.00
R1793:Arhgef10l UTSW 4 140515373 missense probably damaging 0.97
R2018:Arhgef10l UTSW 4 140544384 missense probably damaging 1.00
R2093:Arhgef10l UTSW 4 140570290 missense possibly damaging 0.57
R2098:Arhgef10l UTSW 4 140579432 missense probably damaging 1.00
R2310:Arhgef10l UTSW 4 140593118 missense probably damaging 1.00
R2879:Arhgef10l UTSW 4 140515287 missense probably benign 0.09
R2883:Arhgef10l UTSW 4 140516802 missense probably benign 0.02
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3732:Arhgef10l UTSW 4 140581619 small deletion probably benign
R3861:Arhgef10l UTSW 4 140515487 missense possibly damaging 0.94
R4049:Arhgef10l UTSW 4 140515451 missense probably benign 0.05
R4322:Arhgef10l UTSW 4 140542726 missense probably benign 0.07
R4707:Arhgef10l UTSW 4 140536883 missense possibly damaging 0.63
R5395:Arhgef10l UTSW 4 140570290 missense probably benign 0.16
R5720:Arhgef10l UTSW 4 140581619 small deletion probably benign
R6066:Arhgef10l UTSW 4 140577080 missense probably damaging 1.00
R6190:Arhgef10l UTSW 4 140542762 missense possibly damaging 0.90
R6464:Arhgef10l UTSW 4 140586815 missense probably benign 0.05
R6476:Arhgef10l UTSW 4 140611382 missense probably damaging 1.00
R6478:Arhgef10l UTSW 4 140542757 missense possibly damaging 0.91
R6483:Arhgef10l UTSW 4 140616915 missense probably damaging 0.99
R6721:Arhgef10l UTSW 4 140570344 missense probably damaging 1.00
R6890:Arhgef10l UTSW 4 140544419 missense probably damaging 1.00
Z1088:Arhgef10l UTSW 4 140581735 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- GGTTCAGTTCCAAAGAGGCCAGAC -3'
(R):5'- AGCAGGTTGCCTCAGTGATCTTCC -3'

Sequencing Primer
(F):5'- GAGGCCAGACACCAGTG -3'
(R):5'- gaggttcagagagatggagtg -3'
Posted On2013-04-11