Incidental Mutation 'E0370:Mapk11'
ID206418
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #E0370 (G1)
Quality Score222
Status Validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 89146513 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 88 (D88G)
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823]
Predicted Effect probably damaging
Transcript: ENSMUST00000088823
AA Change: D88G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137
AA Change: D88G

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Meta Mutation Damage Score 0.32 question?
Coding Region Coverage
  • 1x: 97.4%
  • 3x: 96.8%
  • 10x: 95.0%
  • 20x: 91.1%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544D05Rik TGCAGCGACTGGACGGCGGCA TGCA 11: 70,616,426 probably null Het
Aire T A 10: 78,042,063 N180I probably damaging Het
Asic3 G T 5: 24,413,987 L92F probably damaging Het
Birc6 G A 17: 74,677,357 D4455N probably damaging Het
Cd36 A T 5: 17,785,749 C464* probably null Het
Cdx1 A C 18: 61,020,429 I179S probably damaging Het
D430042O09Rik A G 7: 125,850,302 D846G probably benign Het
Dnah2 A T 11: 69,515,615 probably null Het
Dst A T 1: 34,249,471 probably benign Het
Epb41l3 A G 17: 69,274,804 N580S possibly damaging Het
Hnrnpm A T 17: 33,658,922 probably benign Het
Map2 A T 1: 66,416,724 probably benign Het
Marc1 T C 1: 184,795,228 probably benign Het
Mbd4 C T 6: 115,849,155 E271K possibly damaging Het
Mpp4 T G 1: 59,139,758 probably benign Het
Muc2 T C 7: 141,696,355 Y609H probably damaging Het
Olfr918 A T 9: 38,672,561 D307E probably damaging Het
Pex1 T A 5: 3,631,614 probably null Het
Prdm11 T C 2: 92,980,579 Y225C probably damaging Het
Psmc3 T A 2: 91,055,118 probably null Het
Slc26a8 A T 17: 28,642,387 D774E possibly damaging Het
Slc9a2 A T 1: 40,763,541 probably null Het
Smc1b A G 15: 85,127,581 Y168H probably damaging Het
Steap1 T C 5: 5,740,673 R92G probably damaging Het
Tbx22 T C X: 107,685,153 I430T probably benign Het
Tfap4 T A 16: 4,559,470 H16L possibly damaging Het
Tnxb A G 17: 34,678,943 D855G probably damaging Het
Trip13 A G 13: 73,920,439 probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn2r121 A G X: 124,127,920 V801A probably benign Het
Wiz C T 17: 32,355,118 R935Q probably damaging Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5422:Mapk11 UTSW 15 89146285 missense probably damaging 1.00
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGTAGACAAGGAATTGAACATGC -3'
(R):5'- CGGTGATGTTGGGACTGAAC -3'

Sequencing Primer
(F):5'- GAATTGAACATGCTCATCGCTCAGG -3'
(R):5'- CTGAACAAGGGACGCATCCTG -3'
Posted On2014-06-23