Incidental Mutation 'R1822:Pkhd1'
ID206429
Institutional Source Beutler Lab
Gene Symbol Pkhd1
Ensembl Gene ENSMUSG00000043760
Gene Namepolycystic kidney and hepatic disease 1
SynonymsFPC, tigmin
MMRRC Submission 039850-MU
Accession Numbers

Genbank: NM_153179; MGI: 2155808

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R1822 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location20057779-20618064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 20347457 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 2490 (G2490V)
Ref Sequence ENSEMBL: ENSMUSP00000085794 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088448]
Predicted Effect probably damaging
Transcript: ENSMUST00000088448
AA Change: G2490V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: G2490V

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:IPT 134 254 1e-45 BLAST
IPT 256 353 1.13e-3 SMART
low complexity region 722 743 N/A INTRINSIC
low complexity region 896 909 N/A INTRINSIC
Pfam:TIG 936 1005 9.1e-8 PFAM
IPT 1016 1101 1.18e-6 SMART
IPT 1105 1190 1.27e0 SMART
IPT 1193 1290 7.05e-5 SMART
IPT 1384 1467 1.36e1 SMART
IPT 1568 1655 2.4e0 SMART
low complexity region 1881 1892 N/A INTRINSIC
G8 1928 2049 1.15e-48 SMART
low complexity region 2079 2094 N/A INTRINSIC
PbH1 2244 2266 7.82e3 SMART
PbH1 2287 2321 2.23e3 SMART
PbH1 2404 2426 7.19e2 SMART
PbH1 2459 2481 2.64e2 SMART
low complexity region 2713 2728 N/A INTRINSIC
G8 2734 2867 1.73e-43 SMART
Blast:G8 2876 2923 2e-17 BLAST
PbH1 3004 3026 3.98e3 SMART
PbH1 3027 3049 1.27e0 SMART
PbH1 3080 3102 5.92e2 SMART
low complexity region 3178 3187 N/A INTRINSIC
PbH1 3188 3212 8.08e3 SMART
transmembrane domain 3852 3874 N/A INTRINSIC
Meta Mutation Damage Score 0.314 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.7%
Validation Efficiency 97% (105/108)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik T C 19: 29,716,414 N1960S probably damaging Het
Abca8b G T 11: 109,957,075 T798K possibly damaging Het
Abtb1 T C 6: 88,836,554 T401A probably benign Het
Adsl G T 15: 80,962,742 E70* probably null Het
Ahcyl2 A G 6: 29,768,584 probably benign Het
AI314180 A G 4: 58,805,539 probably null Het
Akr1a1 A G 4: 116,636,653 V310A probably benign Het
Alpk3 T A 7: 81,076,931 C121* probably null Het
Amph T A 13: 18,948,455 I8N probably damaging Het
Ano2 G A 6: 125,863,457 A364T probably damaging Het
Apbb2 T C 5: 66,400,177 T314A probably benign Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atf7ip A G 6: 136,587,260 T834A probably benign Het
Brca2 T G 5: 150,540,198 D1142E probably benign Het
Cap2 A G 13: 46,615,347 S210G probably benign Het
Capn2 C A 1: 182,472,960 E596D possibly damaging Het
Cdc27 A T 11: 104,522,822 S358R probably benign Het
Cdhr3 C T 12: 33,045,205 G622S probably null Het
Clip2 A G 5: 134,503,227 Y540H probably benign Het
Crhr1 A T 11: 104,133,072 M1L probably benign Het
Csmd1 T C 8: 16,223,326 T831A probably damaging Het
Cwc22 T C 2: 77,924,659 probably benign Het
Cyp3a25 T A 5: 145,984,953 K390N probably damaging Het
Cyp4a31 T C 4: 115,566,613 probably null Het
Cytip A C 2: 58,134,146 S221A probably benign Het
Dagla G A 19: 10,263,186 R227C possibly damaging Het
Dhx57 A G 17: 80,253,085 probably null Het
Dnah2 A T 11: 69,514,804 D627E probably damaging Het
Dock8 A G 19: 25,161,058 E1249G probably benign Het
Dpysl3 A G 18: 43,342,328 V31A probably benign Het
Fan1 T C 7: 64,372,806 N233S probably benign Het
Fras1 A T 5: 96,770,688 I3528F probably damaging Het
Glipr1 T A 10: 111,996,860 M58L possibly damaging Het
Gm10509 C T 17: 21,690,858 P31S possibly damaging Het
Gm5070 T C 3: 95,411,044 noncoding transcript Het
Gramd1a T C 7: 31,142,573 N138S probably damaging Het
Grk5 T C 19: 61,089,972 V489A probably damaging Het
Hmcn2 C T 2: 31,383,692 S1352L probably damaging Het
Hoxa5 G A 6: 52,202,732 T221I probably damaging Het
Hsd17b2 C A 8: 117,758,749 P317Q possibly damaging Het
Ifi213 T A 1: 173,589,842 S335C probably damaging Het
Izumo4 A T 10: 80,703,895 D156V probably damaging Het
Khnyn A T 14: 55,885,852 E21V probably damaging Het
Kmt2d C T 15: 98,861,780 G1199E unknown Het
Lipk T C 19: 34,039,091 W240R probably benign Het
Lpar5 A G 6: 125,081,415 D33G possibly damaging Het
Lrp11 A G 10: 7,596,197 D219G probably damaging Het
Lrrcc1 T C 3: 14,559,225 probably benign Het
Man2a1 T C 17: 64,740,842 C252R probably damaging Het
Map2k5 A G 9: 63,235,303 F354L possibly damaging Het
Mlh3 T C 12: 85,266,145 probably benign Het
Mmp28 A G 11: 83,444,219 I331T probably damaging Het
Muc4 G C 16: 32,753,919 R1265P probably benign Het
Myo3a A T 2: 22,340,280 Y509F probably damaging Het
Nckap1 A G 2: 80,517,898 S898P possibly damaging Het
Nectin1 T A 9: 43,791,077 Y40* probably null Het
Neurl1a T A 19: 47,257,459 V493E probably benign Het
Ntf3 A C 6: 126,102,246 I99S probably benign Het
Olfr1115 T C 2: 87,252,710 S258P possibly damaging Het
Olfr1386 T A 11: 49,470,968 F272L probably benign Het
Olfr318 A T 11: 58,720,307 V247E probably damaging Het
Olfr365 C G 2: 37,201,980 H246Q probably damaging Het
Olfr406 A G 11: 74,270,240 T284A probably benign Het
Olfr421-ps1 C T 1: 174,152,214 R233C probably benign Het
Olfr94 A G 17: 37,196,831 probably benign Het
Otof G A 5: 30,378,710 T1343I probably benign Het
Otop2 A T 11: 115,324,628 Y125F probably benign Het
Pate3 G A 9: 35,646,105 T85I probably benign Het
Pdpk1 A T 17: 24,098,176 probably benign Het
Phf11d T C 14: 59,356,329 H132R probably benign Het
Pik3c3 G A 18: 30,344,077 probably null Het
Prkdc G A 16: 15,759,605 D2372N probably damaging Het
Ptprq C T 10: 107,718,478 E129K probably damaging Het
Pym1 G A 10: 128,766,044 probably benign Het
Ralgapb T A 2: 158,492,452 V1027E probably damaging Het
Rita1 T C 5: 120,609,580 T218A possibly damaging Het
Rrh T A 3: 129,812,633 T218S probably damaging Het
Scaper C T 9: 55,859,900 A416T probably damaging Het
Scn3a A G 2: 65,484,372 L1115P probably damaging Het
Serpinb6e A T 13: 33,833,234 S268T probably damaging Het
Slc1a6 G A 10: 78,812,931 W495* probably null Het
Slc32a1 A G 2: 158,611,378 H46R probably benign Het
Slc37a1 C T 17: 31,300,431 probably benign Het
Slc6a5 T A 7: 49,956,425 W694R probably benign Het
Smarcd2 A T 11: 106,267,396 D113E probably benign Het
Sod3 G T 5: 52,368,162 V68L probably benign Het
Srpk3 G A X: 73,777,955 R425Q possibly damaging Het
Sspo A T 6: 48,492,886 Q4506L possibly damaging Het
Stam2 T A 2: 52,716,527 E115D probably damaging Het
Sult1c1 A T 17: 53,973,925 L50H probably damaging Het
Tbc1d22a T C 15: 86,235,569 V22A possibly damaging Het
Togaram1 T G 12: 64,995,635 V1156G probably damaging Het
Tpp1 T C 7: 105,749,647 T192A probably benign Het
Ttc37 C A 13: 76,130,288 H574N probably benign Het
Ush1c A G 7: 46,209,901 L498P probably damaging Het
Vit A C 17: 78,622,836 Q410P probably benign Het
Vmn2r27 C T 6: 124,231,634 G51S probably benign Het
Zfp341 A G 2: 154,646,134 E839G possibly damaging Het
Zhx3 G A 2: 160,780,355 L631F probably benign Het
Zmpste24 T C 4: 121,087,316 E95G possibly damaging Het
Other mutations in Pkhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Pkhd1 APN 1 20566874 critical splice acceptor site probably null
IGL00687:Pkhd1 APN 1 20524070 missense probably benign 0.19
IGL00824:Pkhd1 APN 1 20081184 critical splice donor site probably null
IGL00870:Pkhd1 APN 1 20571390 missense probably damaging 1.00
IGL00911:Pkhd1 APN 1 20117747 missense probably benign 0.00
IGL01015:Pkhd1 APN 1 20523258 missense possibly damaging 0.95
IGL01025:Pkhd1 APN 1 20209176 missense probably benign 0.04
IGL01064:Pkhd1 APN 1 20534530 splice site probably benign
IGL01313:Pkhd1 APN 1 20201024 missense probably damaging 1.00
IGL01340:Pkhd1 APN 1 20522977 missense probably benign 0.01
IGL01352:Pkhd1 APN 1 20549715 missense probably benign 0.34
IGL01456:Pkhd1 APN 1 20199459 missense probably damaging 1.00
IGL01530:Pkhd1 APN 1 20559419 critical splice donor site probably null
IGL01557:Pkhd1 APN 1 20116979 missense possibly damaging 0.59
IGL01655:Pkhd1 APN 1 20534633 nonsense probably null
IGL01790:Pkhd1 APN 1 20558671 missense probably damaging 0.96
IGL01862:Pkhd1 APN 1 20358910 missense probably damaging 1.00
IGL01874:Pkhd1 APN 1 20103235 missense probably benign 0.32
IGL01901:Pkhd1 APN 1 20220083 missense probably benign 0.11
IGL01903:Pkhd1 APN 1 20198137 missense probably damaging 1.00
IGL01981:Pkhd1 APN 1 20523567 missense possibly damaging 0.64
IGL02068:Pkhd1 APN 1 20522747 missense probably damaging 1.00
IGL02083:Pkhd1 APN 1 20201227 missense probably damaging 1.00
IGL02084:Pkhd1 APN 1 20377399 missense probably damaging 1.00
IGL02126:Pkhd1 APN 1 20117195 missense probably damaging 1.00
IGL02136:Pkhd1 APN 1 20275615 missense probably damaging 1.00
IGL02255:Pkhd1 APN 1 20584101 missense probably damaging 1.00
IGL02272:Pkhd1 APN 1 20209260 missense probably damaging 1.00
IGL02308:Pkhd1 APN 1 20070376 critical splice donor site probably null
IGL02364:Pkhd1 APN 1 20200783 missense probably benign
IGL02389:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02394:Pkhd1 APN 1 20199486 missense possibly damaging 0.57
IGL02403:Pkhd1 APN 1 20562418 missense probably benign 0.01
IGL02415:Pkhd1 APN 1 20414421 missense probably damaging 1.00
IGL02415:Pkhd1 APN 1 20522759 missense probably damaging 1.00
IGL02455:Pkhd1 APN 1 20364201 missense probably damaging 1.00
IGL02502:Pkhd1 APN 1 20392165 missense probably damaging 1.00
IGL02511:Pkhd1 APN 1 20073507 missense possibly damaging 0.90
IGL02530:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02532:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02534:Pkhd1 APN 1 20117720 missense probably damaging 0.99
IGL02556:Pkhd1 APN 1 20310710 missense probably damaging 1.00
IGL02570:Pkhd1 APN 1 20520256 missense probably damaging 0.99
IGL02605:Pkhd1 APN 1 20550902 missense possibly damaging 0.66
IGL02641:Pkhd1 APN 1 20558752 missense possibly damaging 0.61
IGL02741:Pkhd1 APN 1 20220029 splice site probably benign
IGL02752:Pkhd1 APN 1 20553591 missense possibly damaging 0.57
IGL02890:Pkhd1 APN 1 20361011 missense probably damaging 1.00
IGL02959:Pkhd1 APN 1 20608416 nonsense probably null
IGL02960:Pkhd1 APN 1 20377446 missense possibly damaging 0.69
IGL02990:Pkhd1 APN 1 20522963 missense possibly damaging 0.52
IGL03037:Pkhd1 APN 1 20522699 missense probably benign 0.06
IGL03082:Pkhd1 APN 1 20565633 missense probably damaging 1.00
IGL03114:Pkhd1 APN 1 20198171 missense probably damaging 0.99
IGL03288:Pkhd1 APN 1 20201019 missense probably benign 0.01
IGL03328:Pkhd1 APN 1 20081300 splice site probably benign
IGL03375:Pkhd1 APN 1 20117023 missense probably damaging 1.00
IGL03380:Pkhd1 APN 1 20200670 missense probably damaging 1.00
0152:Pkhd1 UTSW 1 20522894 missense possibly damaging 0.46
IGL03046:Pkhd1 UTSW 1 20537365 missense possibly damaging 0.81
LCD18:Pkhd1 UTSW 1 20611414 intron probably benign
P0035:Pkhd1 UTSW 1 20117347 missense probably benign 0.00
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0063:Pkhd1 UTSW 1 20211950 missense probably benign 0.02
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0071:Pkhd1 UTSW 1 20201344 missense probably benign 0.11
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0094:Pkhd1 UTSW 1 20209246 missense probably damaging 1.00
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0103:Pkhd1 UTSW 1 20523359 missense probably benign 0.04
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0105:Pkhd1 UTSW 1 20523732 nonsense probably null
R0115:Pkhd1 UTSW 1 20350490 missense probably damaging 1.00
R0193:Pkhd1 UTSW 1 20358917 missense probably damaging 1.00
R0245:Pkhd1 UTSW 1 20540400 missense probably benign 0.03
R0277:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0310:Pkhd1 UTSW 1 20549822 splice site probably null
R0323:Pkhd1 UTSW 1 20275538 missense probably benign 0.04
R0395:Pkhd1 UTSW 1 20381547 missense probably benign 0.26
R0412:Pkhd1 UTSW 1 20117788 missense probably damaging 1.00
R0506:Pkhd1 UTSW 1 20559469 missense probably benign 0.00
R0512:Pkhd1 UTSW 1 20310514 splice site probably benign
R0550:Pkhd1 UTSW 1 20347223 missense probably null 1.00
R0584:Pkhd1 UTSW 1 20239436 nonsense probably null
R0586:Pkhd1 UTSW 1 20524111 missense probably benign 0.04
R0598:Pkhd1 UTSW 1 20200890 missense probably damaging 1.00
R0603:Pkhd1 UTSW 1 20117173 missense probably benign 0.05
R0634:Pkhd1 UTSW 1 20117474 missense probably damaging 1.00
R0677:Pkhd1 UTSW 1 20524230 missense probably benign 0.01
R0746:Pkhd1 UTSW 1 20198107 missense probably damaging 1.00
R0781:Pkhd1 UTSW 1 20117484 missense probably benign 0.01
R0840:Pkhd1 UTSW 1 20350521 missense probably damaging 0.98
R0946:Pkhd1 UTSW 1 20199381 missense probably benign 0.10
R1018:Pkhd1 UTSW 1 20201259 missense possibly damaging 0.89
R1028:Pkhd1 UTSW 1 20117726 missense probably damaging 1.00
R1136:Pkhd1 UTSW 1 20522829 missense possibly damaging 0.68
R1178:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1180:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1222:Pkhd1 UTSW 1 20567456 missense probably benign 0.07
R1334:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1335:Pkhd1 UTSW 1 20571405 missense probably damaging 1.00
R1387:Pkhd1 UTSW 1 20555223 splice site probably benign
R1411:Pkhd1 UTSW 1 20373896 missense probably damaging 1.00
R1443:Pkhd1 UTSW 1 20534558 missense probably damaging 1.00
R1448:Pkhd1 UTSW 1 20585157 critical splice donor site probably null
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1468:Pkhd1 UTSW 1 20523341 missense probably damaging 1.00
R1473:Pkhd1 UTSW 1 20522983 missense probably benign 0.00
R1524:Pkhd1 UTSW 1 20117780 missense probably damaging 1.00
R1532:Pkhd1 UTSW 1 20117401 missense probably benign 0.08
R1565:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1572:Pkhd1 UTSW 1 20347440 missense probably benign 0.02
R1583:Pkhd1 UTSW 1 20117825 missense probably benign
R1617:Pkhd1 UTSW 1 20198050 missense possibly damaging 0.95
R1631:Pkhd1 UTSW 1 20522897 missense probably benign 0.06
R1655:Pkhd1 UTSW 1 20584129 missense probably damaging 1.00
R1707:Pkhd1 UTSW 1 20550840 splice site probably benign
R1753:Pkhd1 UTSW 1 20533905 missense possibly damaging 0.81
R1782:Pkhd1 UTSW 1 20565711 missense probably damaging 0.98
R1791:Pkhd1 UTSW 1 20585152 splice site probably benign
R1823:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1824:Pkhd1 UTSW 1 20347457 missense probably damaging 1.00
R1836:Pkhd1 UTSW 1 20117069 missense probably benign 0.01
R1862:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1863:Pkhd1 UTSW 1 20551020 missense probably benign 0.00
R1869:Pkhd1 UTSW 1 20615267 critical splice donor site probably null
R1913:Pkhd1 UTSW 1 20566756 critical splice donor site probably null
R1928:Pkhd1 UTSW 1 20081300 splice site probably benign
R1969:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1970:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R1981:Pkhd1 UTSW 1 20117060 missense probably benign 0.00
R2008:Pkhd1 UTSW 1 20199459 missense probably damaging 0.99
R2034:Pkhd1 UTSW 1 20200669 missense probably damaging 1.00
R2061:Pkhd1 UTSW 1 20612812 missense possibly damaging 0.76
R2062:Pkhd1 UTSW 1 20201335 missense probably damaging 0.97
R2108:Pkhd1 UTSW 1 20553574 nonsense probably null
R2142:Pkhd1 UTSW 1 20523895 missense probably benign 0.00
R2148:Pkhd1 UTSW 1 20414220 critical splice donor site probably null
R2176:Pkhd1 UTSW 1 20553517 missense probably damaging 1.00
R2202:Pkhd1 UTSW 1 20537360 missense probably benign 0.06
R2255:Pkhd1 UTSW 1 20565639 missense probably benign 0.23
R2269:Pkhd1 UTSW 1 20534535 critical splice donor site probably null
R2275:Pkhd1 UTSW 1 20200849 missense possibly damaging 0.95
R2340:Pkhd1 UTSW 1 20200855 missense probably damaging 1.00
R2431:Pkhd1 UTSW 1 20201165 missense possibly damaging 0.63
R2679:Pkhd1 UTSW 1 20209182 missense probably benign 0.03
R2850:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R2851:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2853:Pkhd1 UTSW 1 20058302 missense probably benign 0.16
R2984:Pkhd1 UTSW 1 20222961 missense possibly damaging 0.84
R2987:Pkhd1 UTSW 1 20104599 missense possibly damaging 0.87
R3692:Pkhd1 UTSW 1 20555129 missense possibly damaging 0.87
R3721:Pkhd1 UTSW 1 20585655 missense probably benign 0.08
R3746:Pkhd1 UTSW 1 20058300 makesense probably null
R3838:Pkhd1 UTSW 1 20534629 missense possibly damaging 0.66
R3843:Pkhd1 UTSW 1 20558723 missense probably benign 0.00
R3861:Pkhd1 UTSW 1 20200927 missense probably damaging 1.00
R3893:Pkhd1 UTSW 1 20312138 nonsense probably null
R3926:Pkhd1 UTSW 1 20550873 missense probably benign 0.00
R4183:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20209277 missense probably benign 0.03
R4184:Pkhd1 UTSW 1 20563686 missense probably benign 0.06
R4255:Pkhd1 UTSW 1 20593934 missense probably damaging 0.99
R4275:Pkhd1 UTSW 1 20058384 missense probably benign 0.00
R4342:Pkhd1 UTSW 1 20058617 missense probably benign 0.00
R4386:Pkhd1 UTSW 1 20414292 missense probably benign 0.00
R4402:Pkhd1 UTSW 1 20239411 missense probably damaging 1.00
R4431:Pkhd1 UTSW 1 20523314 missense probably damaging 0.99
R4560:Pkhd1 UTSW 1 20211858 missense probably damaging 1.00
R4561:Pkhd1 UTSW 1 20534719 missense possibly damaging 0.89
R4570:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4571:Pkhd1 UTSW 1 20613409 missense probably damaging 1.00
R4588:Pkhd1 UTSW 1 20200868 missense probably benign 0.00
R4598:Pkhd1 UTSW 1 20503056 missense probably damaging 1.00
R4651:Pkhd1 UTSW 1 20381523 missense probably damaging 1.00
R4657:Pkhd1 UTSW 1 20364167 missense possibly damaging 0.89
R4718:Pkhd1 UTSW 1 20081228 missense probably damaging 1.00
R4740:Pkhd1 UTSW 1 20524130 missense probably benign
R4750:Pkhd1 UTSW 1 20524112 missense possibly damaging 0.57
R4816:Pkhd1 UTSW 1 20199415 missense probably damaging 0.99
R4825:Pkhd1 UTSW 1 20537401 missense probably damaging 0.96
R4885:Pkhd1 UTSW 1 20070488 missense possibly damaging 0.55
R4907:Pkhd1 UTSW 1 20209226 missense probably damaging 1.00
R4944:Pkhd1 UTSW 1 20288205 missense probably null 0.01
R5062:Pkhd1 UTSW 1 20585711 missense probably benign 0.00
R5090:Pkhd1 UTSW 1 20200757 missense probably damaging 1.00
R5104:Pkhd1 UTSW 1 20585191 missense probably damaging 1.00
R5187:Pkhd1 UTSW 1 20209224 missense possibly damaging 0.67
R5202:Pkhd1 UTSW 1 20547341 missense probably benign 0.01
R5240:Pkhd1 UTSW 1 20275641 missense probably benign 0.04
R5248:Pkhd1 UTSW 1 20534545 missense probably benign 0.00
R5252:Pkhd1 UTSW 1 20350411 critical splice donor site probably null
R5293:Pkhd1 UTSW 1 20509076 missense possibly damaging 0.89
R5311:Pkhd1 UTSW 1 20565870 missense possibly damaging 0.94
R5317:Pkhd1 UTSW 1 20450304 missense probably damaging 1.00
R5346:Pkhd1 UTSW 1 20392097 missense probably benign
R5346:Pkhd1 UTSW 1 20523434 missense probably damaging 0.96
R5431:Pkhd1 UTSW 1 20117836 missense probably benign 0.25
R5447:Pkhd1 UTSW 1 20239385 missense probably benign 0.00
R5478:Pkhd1 UTSW 1 20201156 missense probably damaging 1.00
R5497:Pkhd1 UTSW 1 20377404 missense possibly damaging 0.94
R5554:Pkhd1 UTSW 1 20081252 missense probably damaging 0.99
R5579:Pkhd1 UTSW 1 20523142 missense probably damaging 0.96
R5614:Pkhd1 UTSW 1 20073526 missense possibly damaging 0.83
R5648:Pkhd1 UTSW 1 20558626 missense probably benign 0.04
R5651:Pkhd1 UTSW 1 20117807 missense probably benign 0.03
R5665:Pkhd1 UTSW 1 20588531 missense probably damaging 1.00
R5681:Pkhd1 UTSW 1 20547461 missense possibly damaging 0.61
R5754:Pkhd1 UTSW 1 20523651 nonsense probably null
R5760:Pkhd1 UTSW 1 20073554 missense probably benign 0.02
R5776:Pkhd1 UTSW 1 20209185 missense possibly damaging 0.62
R5782:Pkhd1 UTSW 1 20058600 missense probably benign
R5810:Pkhd1 UTSW 1 20200673 missense probably benign 0.26
R5814:Pkhd1 UTSW 1 20199405 missense probably damaging 1.00
R5816:Pkhd1 UTSW 1 20058678 missense probably benign 0.03
R5835:Pkhd1 UTSW 1 20201083 missense probably benign 0.01
R5844:Pkhd1 UTSW 1 20381461 missense probably benign 0.00
R5847:Pkhd1 UTSW 1 20374736 nonsense probably null
R5852:Pkhd1 UTSW 1 20377408 missense probably benign 0.22
R5863:Pkhd1 UTSW 1 20520210 missense possibly damaging 0.63
R6213:Pkhd1 UTSW 1 20523770 missense possibly damaging 0.80
R6351:Pkhd1 UTSW 1 20211951 missense probably benign 0.00
R6386:Pkhd1 UTSW 1 20551020 missense probably damaging 0.96
R6542:Pkhd1 UTSW 1 20585703 missense probably benign 0.02
R6579:Pkhd1 UTSW 1 20200823 missense probably benign 0.01
R6658:Pkhd1 UTSW 1 20612705 missense probably damaging 1.00
R6765:Pkhd1 UTSW 1 20058339 missense probably benign
R6886:Pkhd1 UTSW 1 20347280 missense probably benign 0.01
R6892:Pkhd1 UTSW 1 20523515 missense probably damaging 1.00
R6900:Pkhd1 UTSW 1 20534701 missense probably benign 0.06
R6932:Pkhd1 UTSW 1 20562451 missense probably benign 0.19
X0012:Pkhd1 UTSW 1 20373926 missense probably damaging 1.00
X0067:Pkhd1 UTSW 1 20520226 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGCATTGGTCAAGCATG -3'
(R):5'- CCTACAGAACAAACTGAACTGTGTC -3'

Sequencing Primer
(F):5'- TCAAGCATGTGTCTGAGAGG -3'
(R):5'- CAAACTGAACTGTGTCTGAGTATGCG -3'
Posted On2014-06-23