Incidental Mutation 'R0114:Ppfibp1'
ID20643
Institutional Source Beutler Lab
Gene Symbol Ppfibp1
Ensembl Gene ENSMUSG00000016487
Gene NamePTPRF interacting protein, binding protein 1 (liprin beta 1)
Synonyms
MMRRC Submission 038400-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.614) question?
Stock #R0114 (G1)
Quality Score225
Status Validated (trace)
Chromosome6
Chromosomal Location146888487-147032025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 146998233 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 141 (R141G)
Ref Sequence ENSEMBL: ENSMUSP00000122515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016631] [ENSMUST00000111623] [ENSMUST00000154221]
Predicted Effect probably benign
Transcript: ENSMUST00000016631
AA Change: R255G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000016631
Gene: ENSMUSG00000016487
AA Change: R255G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 345 358 N/A INTRINSIC
low complexity region 426 441 N/A INTRINSIC
low complexity region 530 546 N/A INTRINSIC
SAM 603 670 3.06e-13 SMART
SAM 675 741 2.39e-15 SMART
SAM 763 835 7.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111623
AA Change: R255G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000107250
Gene: ENSMUSG00000016487
AA Change: R255G

DomainStartEndE-ValueType
low complexity region 1 13 N/A INTRINSIC
PDB:3QH9|A 180 256 3e-8 PDB
low complexity region 272 284 N/A INTRINSIC
low complexity region 356 369 N/A INTRINSIC
low complexity region 437 452 N/A INTRINSIC
low complexity region 541 557 N/A INTRINSIC
SAM 614 681 3.06e-13 SMART
SAM 686 752 2.39e-15 SMART
SAM 774 846 7.91e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123902
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126774
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149203
Predicted Effect probably benign
Transcript: ENSMUST00000154221
AA Change: R141G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000122515
Gene: ENSMUSG00000016487
AA Change: R141G

DomainStartEndE-ValueType
coiled coil region 7 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155415
SMART Domains Protein: ENSMUSP00000121270
Gene: ENSMUSG00000016487

DomainStartEndE-ValueType
low complexity region 38 51 N/A INTRINSIC
low complexity region 119 134 N/A INTRINSIC
low complexity region 233 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205056
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.4%
  • 10x: 93.2%
  • 20x: 79.2%
Validation Efficiency 100% (99/99)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. It has been proposed that liprins are multivalent proteins that form complex structures and act as scaffolds for the recruitment and anchoring of LAR family of tyrosine phosphatases. This protein was found to interact with S100A4, a calcium-binding protein related to tumor invasiveness and metastasis. In vitro experiment demonstrated that the interaction inhibited the phosphorylation of this protein by protein kinase C and protein kinase CK2. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik T C 10: 28,985,982 probably benign Het
4933427D14Rik T C 11: 72,195,799 Y262C probably damaging Het
Adamts1 C A 16: 85,799,614 V379L probably benign Het
Akt3 T C 1: 177,067,251 D260G probably damaging Het
Alms1 T C 6: 85,619,803 L537P probably benign Het
Anln A T 9: 22,353,346 I876N probably damaging Het
Ano9 A T 7: 141,103,239 probably benign Het
Arhgef10l T C 4: 140,583,883 E218G probably benign Het
Arnt2 G A 7: 84,347,530 R63C probably damaging Het
Atp9a G T 2: 168,710,856 Y63* probably null Het
Bmpr2 G T 1: 59,815,340 C116F probably damaging Het
Cand1 T C 10: 119,216,522 D233G probably benign Het
Cftr A T 6: 18,282,448 H1049L probably damaging Het
Ckap5 A T 2: 91,620,112 D1975V possibly damaging Het
Cyp26c1 T C 19: 37,686,633 V134A probably benign Het
Dnaic1 T C 4: 41,605,686 probably benign Het
Dpp10 T C 1: 123,486,092 I163V probably benign Het
Fam151a A T 4: 106,734,004 I15F possibly damaging Het
Fanca A T 8: 123,288,491 probably null Het
Fes A G 7: 80,378,035 V787A probably damaging Het
Fnip1 C T 11: 54,487,801 probably benign Het
Gabpb1 A G 2: 126,653,574 I86T probably damaging Het
Gm1840 A G 8: 5,640,359 noncoding transcript Het
Gmds A T 13: 32,227,281 S57T probably benign Het
Gnpat T G 8: 124,883,357 D426E probably benign Het
Gnptab C A 10: 88,433,400 P655Q possibly damaging Het
Herc1 T A 9: 66,461,846 F2941I probably damaging Het
Herc2 T C 7: 56,153,774 probably benign Het
Ino80 G A 2: 119,382,960 R1249C probably damaging Het
Itga11 T G 9: 62,735,293 V166G probably damaging Het
Itga11 T C 9: 62,760,302 V639A possibly damaging Het
Itpr2 A G 6: 146,312,879 F1490S probably damaging Het
Lama2 C A 10: 26,993,068 E802* probably null Het
Lgi3 C T 14: 70,531,029 probably benign Het
Limch1 C T 5: 67,036,084 probably benign Het
Lipc T C 9: 70,803,781 N363S probably damaging Het
Lrit2 A G 14: 37,068,045 probably null Het
Mfsd13a C T 19: 46,366,504 T40I probably benign Het
Mug2 A G 6: 122,040,648 Y448C probably damaging Het
Mybpc3 A G 2: 91,124,494 E450G probably damaging Het
Myo5b A T 18: 74,742,171 T1549S probably benign Het
Naa15 T C 3: 51,448,438 probably null Het
Nckap1l T A 15: 103,455,028 C54S probably benign Het
Nlrp9b A G 7: 20,024,056 D406G probably benign Het
Nprl3 T A 11: 32,239,784 probably benign Het
Nvl A G 1: 181,120,391 V429A probably benign Het
Olfr114 A T 17: 37,589,415 *313K probably null Het
Olfr54 G A 11: 51,027,604 V201I probably benign Het
Olfr548-ps1 A T 7: 102,542,731 Q265L probably benign Het
Olfr801 T A 10: 129,669,598 Y307F probably benign Het
Opa1 A T 16: 29,629,635 N912Y probably benign Het
Pcnx T C 12: 81,996,095 V2317A possibly damaging Het
Phf3 A T 1: 30,805,443 N1478K possibly damaging Het
Phykpl G A 11: 51,586,653 D91N probably benign Het
Polr2b T A 5: 77,343,263 C984S probably damaging Het
Ppm1d G A 11: 85,326,905 G20R probably damaging Het
Ppp1r16a C T 15: 76,690,799 probably benign Het
Ppp2r5b C A 19: 6,228,431 V483F probably benign Het
Ppp4r4 T A 12: 103,576,374 C132S probably benign Het
Prg2 A G 2: 84,983,456 probably benign Het
Prpf4b G A 13: 34,890,488 probably benign Het
Rad54l2 T C 9: 106,713,455 T491A probably damaging Het
Rnf213 G T 11: 119,414,587 W548L probably damaging Het
Rusc2 G T 4: 43,422,055 C825F probably damaging Het
Sema4b A G 7: 80,219,078 probably benign Het
Sema6a A G 18: 47,290,177 V254A probably damaging Het
Slc13a3 A G 2: 165,424,581 F346L probably damaging Het
Slc25a17 T C 15: 81,337,959 D104G probably damaging Het
Specc1 A T 11: 62,146,313 N707Y possibly damaging Het
Tex48 T A 4: 63,608,459 E76V probably damaging Het
Tfr2 T C 5: 137,577,465 V281A probably benign Het
Tgfb1i1 A C 7: 128,249,494 Q238H probably damaging Het
Thoc6 G A 17: 23,670,239 T122I probably benign Het
Tmtc1 G A 6: 148,412,830 probably benign Het
Tnfrsf8 T C 4: 145,288,047 D264G possibly damaging Het
Trim43a T A 9: 88,584,160 I178N probably damaging Het
Ttn G C 2: 76,707,093 I26503M possibly damaging Het
Usp28 C A 9: 49,039,023 D589E probably benign Het
Utp23 T C 15: 51,882,511 S242P probably damaging Het
Vwa3a A G 7: 120,775,380 Y305C probably benign Het
Vwa5b1 C A 4: 138,608,858 E142* probably null Het
Xrn2 A T 2: 147,029,779 T374S probably damaging Het
Zfp735 A T 11: 73,710,662 Q144L probably benign Het
Other mutations in Ppfibp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Ppfibp1 APN 6 147029697 missense probably benign 0.07
IGL02644:Ppfibp1 APN 6 147022440 missense probably damaging 1.00
IGL02711:Ppfibp1 APN 6 147026238 nonsense probably null
IGL02737:Ppfibp1 APN 6 147027308 missense probably damaging 1.00
IGL02745:Ppfibp1 APN 6 147022354 unclassified probably benign
IGL03120:Ppfibp1 APN 6 146998169 missense probably benign 0.00
IGL03300:Ppfibp1 APN 6 147030327 missense probably damaging 1.00
R0480:Ppfibp1 UTSW 6 147019031 splice site probably null
R0699:Ppfibp1 UTSW 6 147026222 missense probably damaging 0.99
R1515:Ppfibp1 UTSW 6 147027432 missense probably benign
R1830:Ppfibp1 UTSW 6 147022259 critical splice donor site probably null
R1858:Ppfibp1 UTSW 6 146990592 missense probably benign 0.06
R2160:Ppfibp1 UTSW 6 147027453 missense probably damaging 0.98
R2389:Ppfibp1 UTSW 6 147022171 missense probably damaging 1.00
R2517:Ppfibp1 UTSW 6 146992444 missense probably damaging 1.00
R3882:Ppfibp1 UTSW 6 146998221 missense possibly damaging 0.67
R4035:Ppfibp1 UTSW 6 146996836 missense probably damaging 0.99
R4202:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4205:Ppfibp1 UTSW 6 147029581 missense probably damaging 1.00
R4420:Ppfibp1 UTSW 6 147026238 nonsense probably null
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4860:Ppfibp1 UTSW 6 146990514 missense probably benign 0.01
R4974:Ppfibp1 UTSW 6 147030419 utr 3 prime probably benign
R5163:Ppfibp1 UTSW 6 147022131 splice site probably null
R5180:Ppfibp1 UTSW 6 147027321 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 146996840 missense probably damaging 1.00
R5388:Ppfibp1 UTSW 6 147016330 missense probably damaging 1.00
R5458:Ppfibp1 UTSW 6 147012435 intron probably benign
R5479:Ppfibp1 UTSW 6 147030150 critical splice donor site probably null
R5631:Ppfibp1 UTSW 6 146996860 missense probably damaging 1.00
R6277:Ppfibp1 UTSW 6 147005924 missense probably benign 0.01
R6577:Ppfibp1 UTSW 6 146999655 splice site probably null
R6602:Ppfibp1 UTSW 6 146978221 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- AGGGACGATCCCAGAACCATGAG -3'
(R):5'- cagaggtCAGATCCAAATGTCATTGGAG -3'

Sequencing Primer
(F):5'- CCATGAGTGTCACCTTGAAATGC -3'
(R):5'- CATTGGAGTTTAAAATGTCATTGGAG -3'
Posted On2013-04-11